Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22540  (registered. 2007)
Contig Information
Length 1855 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_KMP Shoot grown under continuous light 1
Wh_RDr Root of dessiccated seed 2
Wh_VSCB Liquid cultured tissue 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0524400 [Oryza sativa (japonica cultivar-group)] >gi|52353488|gb|AAU44054.1| putative diphosphate-fructose-6-phosphate 1-phosphotransferase [Oryza sativa (japonica cultivar-group)] >gi|55168177|gb|AAV44044.1| putative diphosphate-fructose-6-phosphate 1-phosphotransferase [Oryza sativa (japonica cultivar-group)] >gi|113579641|dbj|BAF18004.1| Os05g0524400 [Oryza sativa (japonica cultivar-group)] >gi|215706321|dbj|BAG93177.1| unnamed protein product [Oryza sativa Japonica Group]
Score 2528
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22540
GTCCACATCATCCTGCCGCCGGACGACGACGACGAGCAGCAGCGGAGGGAGGACGAGGAGAACGACGGCGGCGGGAGCGGGGGCGACGGGCAGCAGCAGC
AGGCCGGGGGCAACGACGCCAAGGCGGCGCTGCCCTTCTCCGCCATGTGCGTGCGGATCTCCCGCGACTCCTACCCCAACCTCCGCGCCCTCCGCAACGC
CTCCCACGCCAGCCTCACCGACGCCGCATACGTCAAGATCTCCGAGGGCGACTTCGGATACGTCCTCGACGACGTCCCCCACCTCGCAGACTACCTCCCC
GACGTCCCCACTTACCCGAACCCACTACAAGACCACCCAGCATATTCAACTGTCAAGCAGTATTTTGTCAATGAAGATGACACCGTACCACAAAAGGTTG
TTGTTCAAAAGAATAGCCGCCGGGGGGTTCACTTCCGTCGTGCTGGACCCCGTCAGAGGGTTAATTTTGAGTCAGATGAAGTGAAAGCATGCATTGTAAG
TTGTGGAGGCCTTTGCCCTGGGCTCAACACTGTTATCAGGGAGCTCGTGTGTGGCTTGGCGCACATGTACAATGTCAACAACATCTTTGGAATACAGAAT
GGATACAAGGGCTTCTATTCTAGCAATTATGTTGCTATTACACCAAAGACAGTCAATGACATCCACAAAAGGGGTGGTACAGTCCTTGGAACATCACGAG
GTGGTCATGATACAAAAAAGATTGTTGACAACATTCAGGATCGGGGAATTAATCAGGTGTATATCATTGGAGGAGATGGAACTCAGAAGGGAGCATATGA
GATCTACAAGGAAATCCGGAAGCGTGGCCTAAAAGTTGCCGTGGCAGGGGTTCCCAAGACAATAGACAATGACATAGCGATTATCGACAAGTCCTTTGGT
TTTGATTCGGCCGTCGAAGAGGCTCAACGTGCCATTAATTCAGCTCATGTGGAAGCTTGCAGTGCTGAGAATGGAATAGGCTTGGTAAAACTGATGGGCC
GTTATAGTGGGTTCATTGCGATGTATGCTACTCTTGCAAGCCGGGATGTGGATTGCTGCTTGATTCCAGAGTCTCCGTTTTATATGGATGGGGAAGGGGG
GCTGCTTCAATATGTAGAGAGGAGGTTGAAAGAGAACAAGCACATGGTTATTGTTGTTGCTGAGGGAGCAGGCCAGGATATTATTGCCAAAAGCATACCC
GCTTCAGATCAGCAAGATGCATCTGGAAATAAGCTGCTTCTTGATATTGGTCTCTGGCTGACTCACAAGATTAAGGACCACTTCAAGAGCAAAAAGATGG
AGATGACGATCAAATACATTGACCCTACCTACATGATCCGAGCTATTCCGAGTAATGCAGCAGACAATGTCTACTGCACACTGCTGGCTCACAGTGCCAT
CCATGGCGCAATGGCGGGATACAGCTTCACTGTTGGGATGGTCAATGGCAGACATGCCTACATACCTTTCTATAGGGTGACGTCCACACGGAACAAGGTG
AAGATCACTGACCGGATGTGGGCGAGGCTGCTGTCGTCGACCAACCAGCCAAGCTTCCTGAGCCAGAAGGACATCGACGAGGCCAGGGAGGCCGATAGGC
TGGCCAACAAGCCGCCGCTGCCATCTGTCGCCAACCACAATGTGGCAAAAGCCTTTGACCAATCTGCATCGGCCTCGTCGAACGGCGAGATATAGCGATG
CGCTGGTCTGTAACCGTGTACAGTAGCTACAGCTATCCTGCTGAGGAACATGTGCCACGCCATGAAGTTTTGCTTCCTTACGATGTCCGTTTGTACGAGT
AGTGCATGTATGGATACTGTTCAGGTGTTATGTGAAATAAGCAGTATATTATTGT
page-top