Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22529  (registered. 2007)
Contig Information
Length 845 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glutathione transferase F3 [Triticum aestivum]
Score 939
Evalue 1.43459e-99
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22529
TATCTCGATAGTCGATGGCGCCGGCGCTCAAGGTGTACGGGTGGGCGGTCTCGCCGTTCGTGGCACGCCCCCTGCTGTGCCTGGAGGAGGCAGGCGTCGA
CTACGAGCTCATCCCCATGAAACGCGAGGCCGGTGACCACCTTCTGCCGGACTTCCTCGCCAAGAACCCCTTCGGCCAGGTCCCCGTTCTCGAGGACGGC
GACCTCACCCTCTTCGAGTCGCGCGCAATTGCGAGGCACGTGCTTCGCAAGTACAAGCCGGAGCTGCTGGTGGGCGACGGCTCGCCGGAGTCGGCGGCGA
TGGTGGACGTGTGGCTGGAGGTGGAGGCCCACCAGCACCACCCCGTGGCGGGCGCCATCTCGATCCAGTGCCTCCTCGTCCCGCTACTCGGCGGCACGCG
CGACCAGGCCATCGTCGACGAGAACGTTGTCAAGCTGAGGAAGGTGCTGGAGGTGTACGAGGCGCGGTTGTCGGCGTCCAAGTATCTCGCCGGGGAGTCG
GTCAGCCTCGCCGACCTCAGCCACTTCCCGCTCATGCACTACTTCATGGAGACGGAGTACGCGTCGCTGGTGGAGGAGCGCCCGCATGTCAAGGCGTGGT
GGGAGGAGCTCAAGGCCAGGCCGGCGGCGAGGAAGGTCAAGGAGTTCATGTCACCGGACTTTGGGCTGGGGAACAAGGCAGAGCAGTGATTGCAACGTCG
GCGTATATGTTGTGTGTGTTTTCAGATTGTTTATCCGGTGTGAATGAAATAAAAAGTGGTCCGGGTCAGTACAATTTCTTTCAAATACCATGTTCGAACC
ATTCAAAAATTGTGTTTCAACCTAGTTTTTTTCTCAAAAAAAAAA
page-top