Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22500  (registered. 2007)
Contig Information
Length 1069 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 7
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0458900 [Oryza sativa (japonica cultivar-group)] >gi|51535252|dbj|BAD38515.1| unknown protein [Oryza sativa Japonica Group] >gi|51536208|dbj|BAD38379.1| unknown protein [Oryza sativa Japonica Group] >gi|113631612|dbj|BAF25293.1| Os09g0458900 [Oryza sativa (japonica cultivar-group)] >gi|125564003|gb|EAZ09383.1| hypothetical protein OsI_31657 [Oryza sativa Indica Group] >gi|125605953|gb|EAZ44989.1| hypothetical protein OsJ_028472 [Oryza sativa (japonica cultivar-group)] >gi|125605962|gb|EAZ44998.1| hypothetical protein OsJ_028481 [Oryza sativa (japonica cultivar-group)] >gi|215769452|dbj|BAH01681.1| unnamed protein product [Oryza sativa Japonica Group] (no hit)
Score 312
Evalue 3.95407e-27
Total Hit Count 0
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22500
ATACGAAGGGCATAACACCAGTAGATTTAACATATACTAGATACTACTAGTACTCGATAGATTATCAGTCTCACAATGACATTGCTTCATCGGTGCGCAA
CAATAGCATCAGGGTAGGCGGATCAATCCCACATATATATGTCCACAGGATCAACTAGAAATATAGATAGATAAGATAGATACATGGTTGGTACTAGATG
GGATAGCAATGGCGAAGCTCCTCGTCAGCTTCTCAGACCACAAGAGCAAGAGCACCGTCGTGGATGGGATTAGGCCCCCACCAAGAAAGGACAGCGAGCG
TTGTTGGCCTGAACATGGCGCTCATACCGCGACATGACCCTGCCGTCGCTGCCGATGTTGTCGTCCTGCGAGTGGTAGCCGTCCGACACATCCCCATCCG
AGTAATCCACTTGGTCCGTCTGTGGCTTGGTGGACTCGATCCACGCCAGGAACGCTGCCCCCTCCTCATCCCGCTCCAACTCCACCTTCCTCTTGGAGCC
ACACTTCTCCGCCTCCTTCTCCGCCTCCGCCTTGGCGTCGAGGAAGTCCTCCTCCTTCTCCAGCAGCGCCACGAACTTGATGAGCGCCTCCTCCTCCTCC
TTGGTGAGGGTCCTCAACTCCACCTTGGCCTTGACCTCCTTTGACTTGGCCTCGACCTCCGGCTTGGCCTCCTTCGCCTTGGCCTCCTTCGCCTTGGCCT
TAACCTCCGGCTTGGCCTCCTTTGCCTTGGCCTCGACCTCCGGCTTGGCCTCCTTCGCCTTGGCCTTCTTCACCTTGGCCTTGACCTCCGGCTTGGCCTT
CTCCTCCTTGGCCTTGGCCTCCTTGACCTCCGGCTTGGCCTTGGCCTTCTTCGCCTCCGCCCTCAACTTGACGGTGAAGGCCTCCAGCTCCGCCCTGGAA
CGTGGTGAAGGGGAAACCCTCCAAGCCGGCGGGCAACGGCATGGACAAGTGCATCTTCTCGACGGCCATCGCCGGATCCGCTCCTCTCCTCTCCTCTCCT
GGTCGTTTCAATCAGGGTTAGGGTTTGGGTTAGGGTTTGGTGGGGATTGGGGATTTCTCGCTCGCTCGA
page-top