Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22444  (registered. 2007)
Contig Information
Length 990 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 5
Wh_RDr Root of dessiccated seed 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_28280 [Oryza sativa Indica Group]
Score 716
Evalue 1.3442e-73
Total Hit Count 381
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22444
ATTATGGAATGCTATTGATGCATAAATCTGTCCCTTCTTACGGCTAAAACACTAGTAGAAGGGAACATCATTCACAACACGATGCAGGTACCACTAAAAC
TCGACAGCATTTATGATAGACGGGTAAACCAAAAGGAGATGAGAAGGCCACTAAAACTGAACAGCATTCACAACACAACACAAGTAAAAAATAAAGAGAA
GAAAACAAGAAAGAACACGGAAGCAAGGATCCACGAACAAGAATTTTGGAACTATGATATTGAAACTATAATAACCTAAGTGGAGGCGAAATAAGGACTA
TGATGTTCACAACTGAAGCAGCAGCAGCCCACGCCTGAACTCGAATCGGCATCTTTTTCCCTTCTCAACTCCAGACGAGCATCAAATCATAGCTGCTCCA
AACTAGTAAATGGCAGAAGATAAATCAACTGCTCTCCTCCACAGGACCTTTAGTTTTGTTTGCGTTGCTTTCTTCGGCCTTGATGGTAGCTGTCTGTGCA
TCATTCATTGAGATGGCACCATCAGCTGTCAGTTTGTTATCACTTTTCTCAATTTCTTTCAGCTGGACACTCCGAGAAAATGAGTCCGCGATATGAGTAA
CAGAATTCCCTACAGCCTTAGCGTCTGTTGGCTTCAGGGACTCTGCGCTGCCAGGCTGCTGCTGACGTCTATTTTCCTTCAAGGCTTTCTCCCGTTGCTC
ATAGAAGTAGAAGTCCTCCACAATGCTTGTCTCGGCCTCATGATTCTTGAATATGCTTAGCATCTGGAGACCATACTCTAGCTTGACCTCCTGGGTGTCC
CTGCTATTTGTTACAGGTTTGTTGTCATTATTCTCAAGTGTGATGTGCCGGAGTAGGGTGTTTGGGACATCCTTAATAATGTGCCACTTCACAGGAAACT
GGCCACTCCACTTGTCTTGCTGCCAATAATCAACACTTCTGTCAAAGTCAACAGGTCCAATCATCTCAGCAACACCACAGAACTGACCAC
page-top