Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22410  (registered. 2007)
Contig Information
Length 1220 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 6
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_025048 [Oryza sativa (japonica cultivar-group)]
Score 1011
Evalue 1.14561e-107
Total Hit Count 307
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22410
TTTTTTTTTTGGGATCTCAATTCCAAATTTTATCAACTCGACGTATTTACAAGTACAAAAGGGGATCAAGATGGCCAGCAGATAGAATCAGATCTCATCT
TGTAGAGGGAGATTTCCTTATATCTACACTAAACAGCAATCACATGCGTCCAAGCTTAAATATGCAGTGATACAAGCAAACACAGGCCCAAACTTATTGC
CCAATTCGTATTTACAAGGCACTAGAGAAAAGAAATTATATGTGGGCTCAGAAACTTTTGCTGTTTTCACCTCCATCTTGTCTAAATAAAAAATCTGGAC
ATAACTTTTCTACCCTCTGCTAGTCATTCCTGGAGTTTGTACGGAGCAAGTCACTCGGAAACCCCATCCTTCAGCTTATTTCAGACTCGTACTGATGTCG
ACCAAGAAGGTGATGGAACTACAAAAATTGTTTCCAATGCATAATACCACATCGTGAGCGCGAGCAGACCATACTTACAATCTTATACTTGATCTGAGCA
GGTAGTTTGTGCATTGGCGACAACCTTGCTCACATTGGAAGACAGCTTTCCTCTTAGCTCAGCACAGACAAGATGTGTCAAGAGGAGCCCAGCAAGAAGT
GCTGCTGCCATCAACATCGTGAACACGGCACTCCAGCTCTCTGTTGAGATGTATCCTGTGAGCAATGGCCCGATTGCGGCACCAACCGACCCGGTCCCAT
CGATGATTGCTGTCACAGTGGCCAGTGCCCGAGAATTACCATTCAATGAGCTGTGAGTGCCAAGGTCAGCTGACACTGCAGTTGTGATCAGGGCATAAGG
ACCATTGACAAACATGCCAGTGATGAACATGAGGCAAATGTTCGACATCATCGACATGCTTCCATATGTTCTGTACAAGAAAAGGGCAGGTATGGCACAG
TACATGAAGCTCGCGGCCGTGATAGCTCGTGCATTTAAGCGATCAGAGATATGACCGGCAAGGACTCCTCCCAACACACCTCCAACATCGAAGACTGTTG
ACAAGCTGCCAGCCATCGCATCAGAGAGGTACTCGTTGCCAATAGGTGTATGGCTGATGTAAAAAGGTAGCCAGTACAGGAAGGTGTATGCAACCAGCTT
GGAGAAGAAGAGGCAGAGAGCAAACGGTGCAACTCCAGGAATCCTCCATGCCTCCAGGAATCCTATTGCCTTATGTTTCACTTCTTGGCCTGGTTCCAAA
AGGGGCTCCTTCGCAGTATC
page-top