Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22390  (registered. 2007)
Contig Information
Length 1094 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os10g0377400 [Oryza sativa (japonica cultivar-group)] >gi|78708412|gb|ABB47387.1| Ras-related protein Rab11D, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113639085|dbj|BAF26390.1| Os10g0377400 [Oryza sativa (japonica cultivar-group)] >gi|215767227|dbj|BAG99455.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218184417|gb|EEC66844.1| hypothetical protein OsI_33317 [Oryza sativa Indica Group]
Score 1002
Evalue 1.07875e-106
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22390
TTTTTTTTTTCTTCTGCCGTAGCAACGCATCAGCATATGAGCTAGTATATAATATATGTATAACATTACATAAAGGCTTGATGGTGTTCTGAGTCATCAT
ACACGGTAATTGATAATCAACCCCACGGCTCGGACCTATGAAAAGGGAGTTCATCTGCTCACTCCCTAACCTCATAGTCAGTGGAGACGAGTGCAAAATC
TTGCTCTGCCACCGACCCCATCCATCTCACCAAATGAACCAATACTTGAAACCTAAGACTACCTCAGTAGGGATCTATATCCAGACAGCGTGAAAAACAC
ACACAAATCCAACAAATCTGGTAGGAGAGATTACATAGAACTGCAGCACTTGCTCTTTGGGATCTCCTGTGCTGGGCCTGGGACAAGAACCTTCTTGCCG
GCCAGCGGCGGCGCAGCACCATTGGCCTTTGGGTCGGTCACAATGTTCTTCTTGCTGTGGATCTTGAAGATCTCTGACAAGACAGTCTGGAAGGCGCTTT
CGACATTGGTGGCCTGCAGCGCAGACGTCTCCAGGAAGAAGAGGTTCTCCTTCTCGGCAAACTCTTTGGCATCCTCAGTGCTAACAGCCCGCTCATCTTC
AAGGTCGCTCTTATTGCCAACCAGCATGATGACAATGTTTTTGTCTGCATGACCTCGGAGTTCCTCCAGCCAGCGAGGTATGTGGTCAAAGCTCTGGCGC
TTGGTGATGTCATAGACTAGCAGAGCTCCCAAAGCGCCTCTGTAATATGCGCTCGTGACAGCTCTGTACCTCTCCTGGCCGGCGGTGTCCCAGATCTGGG
CCTTGACGGACTTGTGGTCGATGACGAGCGTGCGCGTCTGGAACTCGACACCGATGGTGGCCTTGGAGTCGAGGCTGAACTCGTTGCGCGCGAACCGCGC
CAGGATCTGCGACTTGCCGACGGCCGAGTCCCCGATCAGCACCACTTTAAACACATAGTCCACCTTCTCCCCGCTCGCCATCGTCTTCGCTCGTGCAGAA
CGGCGGCGTTGGCGGCAGCCGGAGGAGTGAGCGAGCGAGGCGCGTGGGTCTTGGAGCTGAAGTGCGCGTGGGCGGAGCGCTGCGTGTCGGAGGT
page-top