Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22373  (registered. 2007)
Contig Information
Length 1607 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_OKCS Seed DPA5 4
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0477800 [Oryza sativa (japonica cultivar-group)] >gi|42407860|dbj|BAD09002.1| unknown protein [Oryza sativa Japonica Group] >gi|113624015|dbj|BAF23960.1| Os08g0477800 [Oryza sativa (japonica cultivar-group)] >gi|215694710|dbj|BAG89901.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218201317|gb|EEC83744.1| hypothetical protein OsI_29607 [Oryza sativa Indica Group]
Score 449
Evalue 2.43879e-42
Total Hit Count 49
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22373
TTTTTTTTTTAATCCAAGTCGCGACTTAATATCTTAATAATCAATTCGGTACAGCACTGAGCGACTGCGGCTCGTCTTTGCGCTGATACAGATAGAACTA
ACTGTGCGCTTACGTGCGCAGCAGCTATGTCCGGGCCGAATCTTCCGTAAACAAGAACAGAAATTGGCACTAGTAAACTAGTAGGTAGATCAGGTAGGCA
ACATAACTACAGGTTTCCATACAGAACCAATGGTGTGCTTACAAAATATCATCAACGGGCGACTGCAGCAGAACCCTTCACGTCGAACGGAGATCCCAAC
GGCGCGATCAGGCCCAGGCTCTGCATGATCTTGATCTGGCGCACGCTACGCTGCTCCGATCCCCCCGCGCCCCTGCTAGGAGAAGAGTTGGGGTCCTTGG
TCTCCGGCTTTGCCGCCTTGCCCTTTCTAGGTTTCTTCTTCGCAGCACGGCTTGAGTCAGCCTCCAGCCCACTAGCGGCCCGCTTGGTGCTTAGTCCACC
CTCTGTCTCAGTAGTAGTAGCAGCAGTCGCCTTTGCCTCGGTAGCTTCACAGATTCCAAAGATCACTTCATCCACATATGCCATTTCAGCAGCAAGCTGC
CTGTCTATGACGTCCCCCAGCAGTATATCCCTGACCATAGCTTTTATCTTCCGGTGGGTTCCTTCGACCGTCAAACCAGTTTTGTGCTGGCTTCGATTCA
CGGATGTCATGTCTCCTGCTTCAGCTGCATTTTCACTTGCGCTTGAAACATGGAGCTGTGATGTGCTGTCCTCCGCCGCATCTGAATGTTCCTTCAGATT
GGTACGGCCCGACCGCTTTGAGGATCCTTCCTTTTTGGCCACCGATGTTCCTGATGATGCCTTCTTACCACTCTTTTTATCTCGCACAGCAGAAGCTTGC
TTGGGGTGTCTTATCTCTTAAACCTTCAGCAGAATCTATACTCAAAGCTTTGTCAAGAGCACTTGCTTGCCTCACACCTTTCTGCTTTTTTCCTTTCTGA
GCAGCACCTCCACCTTCTGCATTGCTCCGAACTTCTTGGTCCTGCTCTAAGGCTTCTTGCTTTCTGACTTTCTTAGTAGACGTCTTGGCTTTTGTGTTGA
CAGCTTCCTCCTCGTCATCACTGGCCGACTTAAAATGAGAGAGCTCCTTCTGAAGCACCTCATGGAATGCTTCCATGGCTGTCTTATTTTCTTTCTTCAG
AAACATTTCGAATTCCATGTTAGACTTCCAAGGGTCAACATACAAGTCTAGGCATGTGCCATACAGTCGAACCAGAGCGTCATGGCTGGTCTTCTTCTTG
GCCTTGCTACTGGCACATGCTTCATCAATGACCTGGGCTGGCCACCATGAGGAGCCATCATGCTTAACCCATGTTATATCTCCTAAACAGAAATTCTGCC
TTGGGTTATTTTCTGAGGGTTCAGGACTTGATGTGCATGCAGCCATACGACCATAACTTTTCTCTGCACTTTTCCTCACCATAATGACCAATTCAGACCT
CGCTGCAGGATGCCGCGCGGTCGCCGGCCGGAGTGGTGGAGCAGGCTGCCCCGCTCCCTGGCGACGGCGAGGCTGAGCTGGGTGGAGAGGTCCGGCACGA
GGCCTCG
page-top