Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22372  (registered. 2007)
Contig Information
Length 916 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 5
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_RDr Root of dessiccated seed 2
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ML domain protein [Zea mays]
Score 514
Evalue 3.15477e-50
Total Hit Count 92
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22372
GTGCTTGACAGTGCGGCGCTATCTCTGCCTGGGTGGACAGCGTGCTAGCAGCAACCCACGACAGGTCCTCCACAGATGAACGCCCTTGTCGGGCCATCAC
AGGATGAATGCGGCACCGGCCCCAACCAATCACCCAAAACGCCCATGATTCGTCCAAAGCAACCGCCGAGTCCAACCACACATGTAGACACACACAAACC
TGACATTCAACAATCAAAAAACACGCACTGGCAGCAACTCTGAATAAAACGGCTCAGTCCAACACAGGTTCTCTCACTCGGGGTGATTCAGACAGTTCTG
CGGGTACATACATACGTGGTGTGCTAGCTCTTTGCAACTGCAACCAAGGTCCAAGGGTGTGTTTGGTTCGCGGCACATATTTGGTTCACATAACGGCGAC
AGGCGTGACGAACCCGATGCTGAACCCGAACGAGATGCAGGTCAGCTCCTCGTTCTTGTCTCCCATCAGCTTCATCTGGAGGCTGTAAGAACCTGGCGGG
GTGTAAGATGGCAAGGTCTGTTCGCTGGTTAGTTCGAATTCGCCTGTTGCGGGACAGGGAGTCCCAGCACACAAGTCATGAGTCTCTGAATCGACGTGGA
AAAAGAAGTACCACACATCTACCACCAGCTTCCCTTTGGTGATGGTTTTATCGGTGGAGGCGGAGATCTTGAAGGTGGCGGGCTCGCCGCGCACGACGGG
GTCGGGGACGATCTCCACACCTCTCACCTTCACCGGATAGTGGCGCCCCTTTTTGCAGTACTCGAAGTCGGCGGCGGCGGCGCAGGAGGCGGAGAGCAGG
AGCGCCGCGGCGAGAAGGAGCAGGTCGCGGGGGCGGTGGTTGGGCGCCATCGCTGCGACTGCGAACCAGATGTGCGGGTGTCGCGACTAGACGGAGCAGG
TGGACACGAGCCGCAT
page-top