Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22361  (registered. 2007)
Contig Information
Length 598 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 2
Wh_VABA Shoot with ABA treatment 6
Wh_VWD Shoot grown with dessication 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit tonoplast intrinsic protein [Triticum aestivum]
Score 554
Evalue 3.09874e-55
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22361
CGAGATCGTCATGACCTTCGGGCTCGTCTACACGGTGTACGCCACCGCGGTCGACCCCAAGCGCGGCGACCTCGGGGTGATCGCGCCCATCGCCATCGGC
TTCATCGTCGGCGCCAACATCCTCGCCGGCGGCGCCTTCGACGGCGCCTCCATGAACCCCGCCGTCTCCTTCGGCCCCGCTGTCGTCAGCGGCGTCTGGG
AGAACCACTGGGTCTACTGGCTCGGCCCCTTCGCCGGCGCCGCCATCGCCGCCCTCGTCTACGACATCTGCTTCATCGGCCAGCGCCCCCACGAGCAGCT
CCCCACCGCCGACTACTGAAAACCTCAATCTCATCTCGTCCATCCGTCATCGCCATGAGAGATTGAAATCGCTTCAAAAATTCCAGCAAGTGTACGTCGT
CGCGTCATCATCAGTAAGCCAGTTTAGTTTCATTGCGCTATCTTGTCCTTGAGAAATTCAGGGTAAACAGTGTGTGCGAGTCAGTCAGTCAGGAATAATC
TCATCCTTCTCTTATCTTGGTGTATGTATGTACGTCCTCAATTATGAATGCTTCTATTCCATGGTCAAGATTGATGTTTGTACAAATGAAAAAAAAAA
page-top