Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22298  (registered. 2007)
Contig Information
Length 1089 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_VHS Shoot with heat shock treatment 12
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 16.9a kDa heat-shock protein [Triticum monococcum]
Score 695
Evalue 4.24403e-71
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22298
CCAGCGTCAAGCAAAATCCTACGTACGATCCGATACAGAATTTCCCCCCGAGCTACAAACCGAAGCAACACCGAGAATGTCGATCGTGAGGCGGAGCAAC
GTGTTCGACCCCTTGGCGGACCTCTGGGCGGACCCCTTCGACACCTTCCGCTCCATCGTCCCGGCGATCTCAGGCGGCAACAGCGAGACGGCCGCGTTCG
CCAACGCCCGGATGGATTGGAAGGAGACCCCCGAGGCGCACGTCTTCAAGGCCGACCTCCCCGGCGTGAAGAAGGAGGAGGTCAAGGTGGAGGTGGAGGA
CGGCAACGTGCTGGTCGTCAGCGGCGAGCGCACAAAGGAGAAGGAGGACAAGAACGACAAGTGGCACCGCGTGGAGCGCAGCAGCGGCAAGTTCGTCAGG
CGCTTCCGCCTCCCCGAGGACGCCAAGGTGGAGGACGTGAAGGCCGGGCTGGAGAACGGGGTGCTCACCGTCACCGTGCCCAAGGCCCAGGTCAAGAAGC
CCGAGGTGAAGGCCATCCAGATCTCCGGCTGAGTGCATGCGTCTCGACGTATGGTCATCAAGGATGGAGCCAGTTTGGTTGATGCGTGTGCGAGGTCTGC
AACCTGAATGTATGCTACAGTTGTGTCTTTGTTCTTGCCGATCGAGTCTGGCGAGGCATCTCTGTACTGCGTTTCTTTCGCTGGTCGTTTCTGTTCTTGT
GTAATCGCCAACAGATTTGATGATGAATAAATGAGAAATAAGCCGTTCCGATTTTGGGTGCAGTGCAGATTTTGCATACACAAATTTGACCTTTCTTTGC
TTGTACTAGTTCGGATGGACAGTTTTCTCAAGTAGCTGAAAAGATTCATTGTACACAAGGAAAGATTCACTGAAAATGGCAGCCTGGCAAGCAGGTACTA
GGTCTGCTTAAAGAATAATCGATACACGAATCCGTCTCACATTCAGCTTTCATTAATCGTGGGTCTACACTGATCAATACCCTGAATGCCCTGATTGTTG
ATTGTGTGACTTCTATCTCACCTTCAGTTTTCTTCTTTCTTGAGACATACTTTCAGTTTTCTTTTATCTTTTTTCTTTGAAAAAAAAAA
page-top