Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11744  (registered. 2012)
Contig Information
Length 1724 bp
Clones alternative view 22 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_KMP Shoot grown under continuous light 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 2
WH_XB Root 2
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XE Seedling, infected with leaf rust 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125546496|gb|EAY92635.1|| hypothetical protein OsI_14379 [Oryza sativa Indica Group]
Score 692
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11744
TTTGACTGTGCGCGACACCCCTCCGACCTCAACCTCAACTGGCCGCCGACCGACAGAGAGGAGAGGAGAGGAGAGGAGCACCAACCACAACCGCGGCTTC
TTCCTTCCTTCACCTCGCCGTCAAGCCCCCGCCCCCCTCTTCGTATATACTCCTCAACTCACGCGCTCTCCTCCTCGCCCCCCACTTGCCTAACTCAACC
TCCACCCCTACCAGCCAGATCTCCCTTCCCTTGCCGCCGGAGCCATGGCGTTCGACGCCTTCACCGACAAGACCGCCGTCTTCCGCCGCCTCAAGGCCAA
GCCCGAGAACAAGATGTGCTTCGACTGCAACGCCAAGAACCCCACCTGGGCCTCCGTCACCTACGGCATCTTCCTCTGCCTCGACTGCTCCGCCTTCCAC
CGCAGCCTCGGCGTGCACATCACATTCGTCAGGTCAACGAACCTGGACTCATGGACTCCGGATCAGCTAAAGATGATGGCTTTTGGAGGCAACAATCGTG
CACATGCTTTCTTTAAACAGCACGGGTGGACAGAGGGGAGTGGCAAAGTCGATTCAAAGTACACATCCAGGGCTGCTGAATTGTACAGGCAGATACTGCA
AAAGGAAGTTGCTAAGAGCTCCACCGTCAATGTCTTGCCATCATCCCCTGTTGCAGCGTCTCAGCCACCGAATCCGACCGACGACTTCCCTGATTTCAAG
CTTGCTGATGCACCAGAAGAGACTACCAACGGGAAGCATGAACCTCTTGTCGCCAATCCGCCAAAAGAGCCTGCCCAGGCTCCAAAAGCCCCTACACACC
CCACTTATGTCAGTTCTGTAAAGAAGCCCCTTGGTGCAAAGAAGGTTGGCGCCAAGACTGGGGGCCTTGGTGTAAAAAAGCTAACTACGAAGTCAAATGA
AAGCCTGTATGATCAGAAACCTGAAGAGCCAAAACCTGCTTTACCAACAATGACGACTACTACTTCAGCTGCAAAAAGTGGCCCATCCTCACATTCGCGT
TTTCAGTATGTGGAGAATGAGCCGTCAACAGAGTCAAAAACTGGAGGAGGCAACAAAACTGGCCATGTAGCAGCACCAAAAACCTCAGACTTCTTTCATG
AGTATGGAATGGATAATGGCTTCCAAAGGAAAGCCGGCACAGCTGCCTCAAAGACTCAGATAGAGGAAACTGATGAAGCAAGGAAGAAATTTTCGAACGC
GAAAGCAATTTCATCATCACAGTATTTTGGTAACACAGACAGAGAACAAAAGGAGGCTCAGTTATCTCTTCAAAAGTTTTCGGGTTCATCATCCATTTCA
AGCGCTGATCTGTTTGGCCGTGATACAAATGATTCTGATCTGGACGCAAGTGCTGCAGATCTCATCAACAGAATATCTTTCCAGGCTTCCCAGGATTTGT
CATCTCTCAAGAACATGGCCGGAGAAACCGGAAAGAAGCTGACATCTTTTGCCTCAAATTTTATCACCGACCTCGACAGAATTCTGTGAGGTGTTGATTG
GCTGAAATTGTGGGCATTTCTCTGCACGCAGAAGTAGTGCTCTCGGAGTGACTTGAGCATTTATTGCACAGCTATGTAGAGAATATTAGAGGGTTGTTAC
TATTATCATGAATGTGTATCATTCGCATGCATTTATCAAAATCTTGCTATAATGAAAATATTGTTATTATTCATTTGTTGACAATAGGCGATATTGTACT
TGTTACAAAAAAAAAAAAAAAAAA
page-top