Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22279  (registered. 2007)
Contig Information
Length 1769 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_PCDAM Anther at meiosis 2
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 1
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1050
Evalue 4.83061e-168
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22279
CTTTCCACTCTGGAGTCGTCGTCTCTGCTCCGGTCTCCGGAGAAAAGCAAAGCCAGCGCCGAGCAGCAAGCCCCACACGCCAATTCGGAATCCTTCTCCT
CCCCTCCGCCCCCGCGATCCCGCCCCTCGCCGCCTGCCTGATCGGCCTGCTTCCTGCCGGGGTCTCGTGGGTGTACGGAAGAGAGCATTTCTTAGTTGAG
GATGTACAGTTAATCTGCAGCAGCTCGAGTTGTAGCATTTGGATCTTCTGACATGGCTGAAGGGGCAAGGTTTCATGGCATGGTTGGCGGTGGCGGCAAG
GGGATGCAAGAGAACGAGTTCAATGGCTTCTTCAGCATGCCCTACTATCAGAAAATTGGGGAGGGCTCCCACATGTCTGTCGACAGCACTGACAACTACA
ACCTCGCCGGTGGCTCCGTTACCATGTCTGTGGACAACAGCAGTGTGGGCTCGAACGAGTCCCGCACCGTCATACTTAAGCACCCGGGCCTCCGTGATGC
CCCAACTGCAAGCTATTCGGTTGGCAACAGTGTCTTTCGTCCCAACCGTGTGGCTGCGCACACCCTAAATGAAGATGCATTGGCCAGGGTTCTGATGGAC
CCAAATCATCCAACAGAGATACTTAGCAAGTACCAGCAGTGGGCCATTGATCTGGGGAGGTTGGATATGGGGGTTCCCTTTGCACAGGGAGCCTTTGGGA
AGCTGTACCGGGGAACATATATTGGAGAAGATGTTGCCATTAAGCTGCTGGAGAAGCCTGACAATGATATCGAGAGAGCACAATCGTTGGAACAGCAGTT
TGTGCAAGAAGTTATGATGTTATCTACCCTAAGGGCACCCAAATATAGTAAGATTTATAGGGGCTTGCAGGAAGTCAATTGTGTGGTGCATTATTACTGA
GTATGCAAAAGGTGGCTCAGTCAGGCAGTTCCTGGCAAAAAGGCAGAACAAGTCGGTACCTTTGAGGCTGGCTGTCAAACAAGCATTGGATGTAGCGAGG
GGAATGGCGTATGTGCATGCTCTGGGATTTATCCATAGGGACCTGAAGTCGGATAATCTTCTAATTGCAGCAGACAGATCCATTAAGATTGCTGACTTTG
GAGTTGCTCGAATTGAAGTGAAAACAGAGGGGATGACACCAGAGACAGGAACCTACCGCTGGATGGCACCGGAAATGATCCAGCACAGGCCTTATGATCA
TAAGGTTGATGTCTACAGCTTTGGGATTGTCTTGTGGGAGCTTATAACTGGCATGCTTCCTTTCACAAACATGACAGCTGTTCAGGCGGCTTTTGCTGTT
GTAAATAAGGGTGCTCGTCCAGCGATCCCACATGACTGCCTGCCTTCCCTAACCCACATCATGACGCGCTGTTGGGATGCAAACCCTGAAGTTCGCCCAC
CATTCACCGAGATCGTCTGCATGCTTGAGAACGCCGAGATGGAGGTCGTGAGCCATGTCCGTAAAGCGCGCTTCCGCTGCTGCGTTGCTGAACCCATGAC
CACCGACTGAAACTAAAGCAGGTTAGACTATCGCAGCGGGCATTAGGGAAGAAAACAGGTAAGGATGAAGAAAAGAGGCAATGCCAATGTGTTCATCGTT
GTCAGTGCGTGGGGTCTGTGTGCCTTTACCAGTGCGCATTCTGTCTTGTGTAAGTTGCACACCTCAAGTAAAAGTAATTTCGTATAGATGTTGCCTTGTA
TGCTAACAAAGACCTAATGGAGCTTTTCCGTGTTAATAATATCCGCTTGCTCTTGTACCAAAAAAAAAA
page-top