Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22271  (registered. 2007)
Contig Information
Length 793 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 9
Wh_OKCS Seed DPA5 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 603
Evalue 1.1763e-60
Total Hit Count 275
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22271
TTTTTTTTTTAACAAAGACTTGATCGATTATTGAATATTCACGTAGCATTACATCGTTGGTAATAAAAATTAATGGAAGCAAACTCGCAAAATAAAAAGA
TACTCCACGCACGAGACGCACCACACGTACGTACTCATGCCAATGAGTGCACCGCAGATCACTCGTATAGTCGTATCACAGACAGGTACTATAGGCACCA
GCACAAACCATAGTATGAACGCCGGGACGTCGATCGATCACTGCTTGTCGTTGGCCTCGGTGGCGGCGGCGGCAGCAGGGTCGTCCTCGTCGGCGAAGGC
GGCGGCGGGGAAGGAGCGACCGATGCCGACGTTGGACTTGAAGTAGACCTTGTCGGCGCCGTCGAGGCTCATCTCGACGATGGGCACCCAGAGCATCATC
TGCTTGCTCCGGACCCCGGTCATCCGCTTCATCCGCCCTTCCTCCACGTACGCCGTCACCTCGGCGTCGTAGCGCACCCGGGTGCCCGTGGCGCGGAAGT
GGTGCTCGTAGGGCTTCCCCTGCCGCATCCACACGTAGCCGGTCTCCCGCACCAGCCCGCACTCGTCCAGCCCGCGCAGCGGCATCACCCCGCCCGGGAA
CCCCAGCCCCTTGAGGAGCTCCTTGGAGTGCTCGTAGCACGCCTCGGCGCCTGTGATGATCTCCGCGCCCTCGCGCTGCTTGTTGGCGTTGCCGGCCGCC
GGTGTCGTCTGCGAGACGGTGAGGGAGGCCATCTTCGCTGTTGACTCTCCTGGCTTTGCTAGCTGAAACGTGCTGGTCGAGCTGTGGCTAGCT
page-top