Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11740  (registered. 2012)
Contig Information
Length 811 bp
Clones alternative view 100 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_RDr Root of dessiccated seed 7
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 1
Wh_VSCB Liquid cultured tissue 7
Wh_VWD Shoot grown with dessication 1
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 7
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 7
WH_XA Root 23
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 7
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 3
WH_XF Seedling, infected with leaf rust 6
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|471319|emb|CAA54065.1|| HvB12D [Hordeum vulgare subsp. vulgare]
Score 179
Evalue 4.00E-43
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11740
AAACAAGTAGGTAGATAAGATATTCTAAACCAGGTTATATGATAATTAACACCTAGAGGTGATTCTTTCTCCCCGGAATGTAGCAGCTGGGGTCTTAGCG
GTACTGGAAACGGTTCTTCTCACCTCGTGCCGAATTCGGNNNGAGGCGCGTCTCCACTTTCCTCTCCATCTCACTCACTCTCTCCCTCCGCCGCCGGCGC
AGCGTCCTCCCCGCGACTCCGATGGCCAGCAAGTGGGTCAGGCCCGAGGTGTACCCGCTGTTCGCGGCGACGGGCGTGGCCATCGGCATCTGCGCCTTTA
GCCTCCTTCGCAACATCACCGGCAACCCAGAAGTCAGGGTCAACAAGATGGGGAGGGCAGCGGGAGTGCTTGAGAACCATGAGGAGGGCAGGCGCTACGC
CGAGCACGGCCTCAGAGCCTATGTGCAGGACAAGACCCCCGAGATCATGCCAGGAATCAACAAGTTCTTCACCAGCCCAAAATGAAGCACTTTAGTCTGT
CTGTGACTCGCAATTAGTAACTGTTGTGGTCAAGTGCAAACCTATTTCAAGCATTCAGTAATGTTGTTGCGTCCATAATTCAGAGGACATCGTCAATTAC
CTCTTATTGAAAGAACCATGTGATGTTTGATGGCTTGCTATATATGTGATGGTTGATGGCTTCTAAAAAAAAAAATCATTGAGATTGTGGATATTCCATG
CTTCCGTGTAGTTGCTGTGTTGTGGTTGTGGAGACCTCAGTGGTAGCTCAGCGATTACTGCAGACATTTGGATATTGCTACTGCTGGTAAAAAAAAAAGT
GTTCCTGTCTT
page-top