Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22234  (registered. 2007)
Contig Information
Length 1957 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Physcomitrella patens subsp. patens] >gi|162664053|gb|EDQ50787.1| predicted protein [Physcomitrella patens subsp. patens]
Score 1659
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22234
CGACTTCATGCCATTACAATAAAGGCCGTTCTCCAGCGAACAACTGAGCAATTGCTTCTGGCTCTTATTATGCATAATACAGTTATACAACAATGGGTAT
AATGTAGCAGTAGCAATGAACACCCTACTACACTGGCAGCCAAAACCCTATGGGCAGCCACCGCCATCCATGCCTGACATGTCGAACTGCGAACCAAAGC
CGTCTTCCGATCATGATGTCTGCTCACTCGTAAGGGTTCCTGAAGTTCTTGAGCAGCTCCGGGATGTCGTACCCGAGCATGTCGTCCACCGCCTGGATCA
TCTTGGGCTTCACCTTCTCGAACCTGTCGATGCTGTACCCGCCCAATGCTTCTCTGAAGTGCTCCACGTAAGGGAAATCCCCCGCGGGGAGATGATGTTC
CCTTTGCACCTTTGCAAACTCGCCCTCCAAATTGTCTATAAGTTTCTGCTGGGCTTTAGCTTTCCCCATCATCGTAGGCATCTGATTCTTTAGATGCCCA
ATTATGTAAGCATGTATCTTAGCAGCTCTAGCACGTTTGACGAATTCATTGATCCTGCGGTCACAAGCTTTCTTTGGTATATCTTTTAGATCAGAAAGGA
GATCATCCTGCTCTTTCTCAAATAGTTCCTTTCCGATCGGGCCAACAGCTGATTCCTTTACTGGTTTATCATTGAACGATCCAATATAAACGCGCGACAC
CTCAGGGGTATTCAATACTTTACCAAGAGACCACATAAGGGCACCATACACTCTCATAAGCTGTTGAGTGTCAATTTGGTCGGCCTTGTTCAGAACTACA
CGTATTTTGTCATCATGTCCACGTAAAGATCCAATGACACGTTTAAACTCATCGCTGATATCAAGCTTATGAGGATCAAACAGAAGCAGGATAAGGTCAC
ACTTGGCAGCAAACCATGATGTAACGCCTGTGAATTCATAGCTACGTTGTGTCCGTTGCTTTTCACCAGAAAGAACACCAGGTGTGTCGACAAACGTGAT
ATGCTCTAGTAGTGGATGTGGCATCTGAGAACATTCGAACTTTGATAAAAACGAAGTCCCAAATGTTGTGAGACCACTGAAAGGCATATCTGCTTGAACA
GCTAAAGTATTCCCGGGAATAGTTCTTTCATCAGGTCCTGACATGACAACAACAAATCTGTCGGTTGTCGGCTCTGGTCCAATATGGGCACCTGGATAGC
TTGTTTTTAGCAGATGTTTGATGAAAGTAGTTTTCCCTGTAGAATATTGACCTAAGAGCATAACCATTGGCTTTGCATCAAAATCACTGTTTGTCAGTAA
CGGGGGACACAAAATCATTGAATTTGTATGTAACTTCCAAAGGCTTCAATTTTTCGATGTATAGTCTTTTTAAACCATCAATGACAGAAGTAACAGCAGT
CAGGGGTATCTTCTTGGATGACTTAGAGTTGAACCAATGGTTAGTAGAAGGTCCTTGTGCCTGAGGAAATCCATCCATATCCTGATCGACCCTCTTTGCC
AGATGCTTGGATTTGGCAAGTTGAGCATCCAAACCCTCCATCACTGGGGGATTGAAGCTGATTAGATCTTCGCGCTGAAGGCTGTCCTGGGATATCTCGT
TCCCCGCTTGCGCCAGAGAGACGAGCTGCATGGCGGTGATGAACTCGCCGAAGCCGAGGTACCCCAGCCGCTTGGAGTCGGCGATGGCCCAGACCTGCTT
GAGGTCGGCGCGGGGGAGGCTGGACATGGCGAAGAACTTGATGGCGTCGGGGCCGGTGATGCGGCCGTCGCCATCTGAGTCGGCGAGGGCGAACCAGTCG
CGGTAGATCTTCTGGTGCTCCTTGGAGCAGCTGCTCGCCGGGTGCTGCCCCCCGATCTCCATGGCTCCCCTCCCCTCCCCTCCCGCCTCGGTCGCCGCGG
CCTCTGCAGCTTGGGGAAAGGGGAAAGCAAAGGTAAAACCCTACTGCGACGCGAGGC
page-top