Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22223  (registered. 2007)
Contig Information
Length 881 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Oxygen-evolving enhancer protein 2, chloroplastic; Short=OEE2; AltName: Full=23 kDa subunit of oxygen evolving system of photosystem II; AltName: Full=OEC 23 kDa subunit; AltName: Full=23 kDa thylakoid membrane protein; Flags: Precursor >gi|21837|emb|CAA40669.1| 23kDa oxygen evolving protein of photosystem II [Triticum aestivum]
Score 888
Evalue 1.25774e-93
Total Hit Count 155
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22223
CCGCGCGCCTGGCCGCCTCGGCGCGCCCTGCGCCCGCCGTCGGGCGCACCCAGCTGTTCGTCTGCAAGGCGAAGAAGAACACGGACTTCGTGGCATACAG
CGGGGAGGGGTTCAAACTGATGATCCCGGCCAAGTGGAACCCCAGCAAGGAGCGTGAGTTCCCTGGGCAGGTGCTCCGCTACGAGGACAACTTCGACGCC
ACCAGCAACCTCTCCGTTATAATCAACCCGACCACCAAGAAGACCATCACCGACTACGGTTCCCCTGAGGAGTTCCTCTCCCAGGTCGGCTTCCTCCTCG
GCCAGCAGTCCTACGGTGGCAAGACCGACTCCGAGGGTGGGTTCGAGTCAGACGCTGTGGCGACGGCGAACGTGCTGGAGAGCTCGGCGCCGGTGGTGGA
CGGTAAGCAGTACTACAGCATAACGGTGCTCACGAGGACCGCGGACGGAGACGAGGGAGGGAAGCACCAGCTCATCACCGCCACCGTCGCCGACGGCAAG
CTCTACGTCTGCAAGGCGCAAGCCGGAGACAAGAGGTGGTTCAAGGGCGCCAAGAAGTTCGTCGAGAACGCCGCAGGATCCTTCAGCGTCGCATAAATAT
ACACGACCGACCGGCGAATTTAATGGAAATTTCCTCAGGGATGAACCGTGTAGAGACCGATCGAGGGCATGCATGTGTGTTTCTTTGATTTGTACATGAG
GATGGATGAACTAAGAGGTCGATTTCCCTCAAGGATTCATGTGTGCACAATGATTAAGAAATCTTAGTAATAATGTTTCATTTTTGTATCTCCTTATCTT
TGTTGGCAGCGCTTCAATTTAGTATTGTGAAGAATGTGTTATCAATGTGTCTATATAAGTTTGGTTTTGCTAAAAAAAAAA
page-top