Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22222  (registered. 2007)
Contig Information
Length 730 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 6
Wh_SHDr Shoot grown with dessication 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit metallothioneine type2 [Hordeum vulgare subsp. vulgare]
Score 159
Evalue 3.06157e-09
Total Hit Count 7
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22222
AAGAAGCACACAGGAAGCTCCTAGCCAACACCAATCAAAGCCTCCATCCAATCCCAAGCAACCTCGAAGATGTCTTGCTGCGGAGGAAGCTGCGGCTGCG
GCAGCGCCTGCAAGTGCGGCAACGGCTGCGGCGGCTGCAACATGTACCCGGAGGTCGAGGCCGCCGGCGCCACCCTCCTCGTCTCCGCCACTGCCACCCA
CAAGGCGAGCTCCGGCGGGATGGAGATGGCGGCGGAGAACGGCGGCTGCGGCTGCACCCAGTGCAAGTGCGGCACCAGCTGCGGCTGCTCCTGCTGCAGC
TGCTAGATCATTGATCATGCATGCGCCGCGTGCATCATATCTATGATCTATCTACCATCTACTACCATGTAACGCTGCCTGATCGAGGGTCTTTGTATGT
ATGTACGCACCTGCCTGCATGAGCAGAGCGGGTGCCATGCCATGCATGTAAACCCCTAAATAAAATCTCCCGTGGTTTTGCTTACATCGTGTTGTTAGAT
CCTCCTCCTATTAGTGTTGCTTTCGGGTTCTTCTTATGCACGAGCAGGATCAGAGGCCGGTCTTTTGTTCTTGGTCTTCTCCTCAAACTGTCGTTTTCCT
CTTCTCTATGGTCCATTTGCGGCAGTATTTTCTTCTTCTGTTGCCGAGTTCTGTATCAGACTGCCTTGTTTTGTGGTTTATCCCTATTCATCTTGAAATA
TAGGTATAGCGCATGAATTTAAAAAAAAAA
page-top