Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22192  (registered. 2007)
Contig Information
Length 1844 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_EM Dormant seed with water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_VABA Shoot with ABA treatment 2
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_18577 [Oryza sativa Indica Group]
Score 2795
Evalue 0
Total Hit Count 289
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22192
TTTACTGTTTATCATGATGCACTTGTACAGCACCGTGCTTGAAGGAGGCTTACAACACAAAGTATTAGTCTTGAGAGACGGAGAACAACATACAACATGT
CACGTCAAAGTTTACAGGTCACAGAGATCTCCATCCAAAACTGAGCCGATCTCATTGCAGGTTTCGATATGCTAGCATAGGGCGGAGGGGCGTGCTATGA
TGGCTATGACTACGAGAAGGTGTCCTCCCTGTCCCCCTCGGCGACCTCACCCTCCTCAATGTTGCTGAACTCCAGGAAGTGCGTCGGCCTGTGGTCCTCA
TGGTAGAAGTCGCGGGGTGTGCCCAGCTTCATGCTGTACTTCATCAGCGGGTCGTGCTTGACTCCCATGAAGTTGTAGTTCCACGGAGCGTTGTCCGGAA
CCATGTAGAATCCAAGGAAGCGGTCGCTGAGAAGCATCTGGACCTTCTCGTAGTGAGTTGGGAGGTACCCTTGTGGGTTGCTCCCGTTGTCCTTGTTGCC
ACGGGCCCACTCATAACCACTTGGTGTCAATTTGTATGCAGTCAACGAGCACGATCCTGGGGTGAAGCTGCAGGTCAAAATGATGCACTTCTCACCATCC
CACTGCTTGTTGTTCTCCAAAATTTTAGCATGTGATGTCAAATCCTGAGGTGATAGCTGAGGAGCTTCATTCGGCTGGGTATGCATCCATCCCAACGGCT
CCAAGTCAGCAAGGAACTCATGCTCTGGGAGATTCGATGGCAAAGTCACCATCTGGTGAGTTCCATGCTGTGGCGGAATGGATATGCATCTGATCTCCTT
GACTTGGGGATTATCCTGTGGACTCAGCCCATACAGGAAACCTGCAACCTGTGTCCGTAGATCTGCTATGCATATGAACTTCTTCAATATATTCTTTGGC
ATGATGTAAGTATAGCCAGTCTCCTTTATATCATCCGAGTTAACATAAATGTGGTTGACACGGAGATACAGGTTTGTAGCAGAGATGGCCCTGACACGCC
AATCTGTCTTCGATGCAAATGCTGCTTGCTCATACGGACTGGTCGTCGTGACGATGAGCTCATCTCCATGCACATTAACTGTCCTCGTTGTCTGTGCAGT
TACCTGATTTGTCTCTCGGGACTGTTTCTCAATCTCAGCTATCTGTTGCCTCTGCTGTGACGGTGGAGCTATTTCAGCACCAAGTATTATATCACGAATC
TCAGATTGCGTAAGTGCAGAAGTATTAACGTTGTTTTTCTTTGCATAATCGGAAAGAATGAGATCCCTGAGCGCACATTCGACCTTCAGCCACTGCTCGT
CAGTCAAAGATGGCCAGATATGATGTGGTTCCGTAACAATCGTCTTGTCAGGCTTCAGCAACATCTTAGCCTTCTCATTATTGACATGCAATGCTCTTAA
TATAAGCACAAGACGAGAGAATGCGGTGTAGGACGAGATACTTTTCAGCCAGTCATCGTATATGTTATAAAGAACCATCTGCGGTTCTGTAGCCTTGAGA
ATAAGATCACCAAACTTCTCAATCTTCAAGCAAGCTTGGAATGGCAGCTGCAACTCACTACCCTTGATAACAATGTTAGGGAAGTCAAGCAGATGGACTT
CCAACGGATCCAACATACCCTTCCTTGTCACAATAATTTGCTTTGGCTGCTCTTCCACAGGAAGAGATCGAACTAAGGCAGCAACCTCCTCAGCTGTTTT
CCACTTGGCCAGCTGCCCTAGACGCTTTTGTCCTGCCCATACACTTGTGTGGATGACCTTAAGAAATAGTTGACCAGTCCTTGGATTGAAAATAAAGATT
GCACCATTTATTGGTTTGGTGGTCAGGTTACCTTCAAAGGTTTT
page-top