Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22159  (registered. 2007)
Contig Information
Length 721 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit non-specific lipid transfer protein 1 precursor [Triticum aestivum] >gi|94315723|gb|ABF14724.1| non-specific lipid transfer protein 1 precursor [Triticum aestivum]
Score 381
Evalue 5.34293e-35
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22159
AGCAAATCTAGCTATTTCATCATCTCTGCCTGAGCTCACCACCACTACTAGTGCTAGCTAGCTTGATCGTGATGGCCCATTCTGCTGTTGCTCAGGTCGT
GCTCGTCGCCGTGGTGGCCGCTATGCTCCTCGCAGCCACGGAGGCGGCCGTATCGTGCGGTCAGGTGAGCTCTGCCTTGAGCCCCTGCATCTCCTATGCA
CGCGGCAACGGCGCCAACCCGTCTGCGGCCTGCTGCAGCGGCGTTAGGAGTCTAGCCAGCTCAGCCCGGAGCACCGCTGACAAGCAAGCGGCGTGCAAGT
GTATCAAGAGCGCTGCTGCTGGGCTCAACGCTGGCAAGGCCGCGGGCATCCCCACAAAGTGCGGCGTTAGCGTCCCCTACGCCATCAGCTCTTCGGTCGA
CTGCTCTAAGATTCGCTGATCGAGCACTTGCTGCCATCGCTGTTGCTGGATCTACGCTTAGTATGTTGAGGTCACACACACGCACACACACATATATATA
TGAATAAATGCTCTCATATTATCTCACTGCGTGAGAGAGAGAGGAGTACGTACGTCAAGCAGCTGTGCATGGCCGGCCCGAGTTTGGTTGTTCCTCCACT
CCCCGAGTATGCTGTACTTTGTACCATGTGTAATTTTGATATATGGATTGTATACTCAGCTGATCAGCTCTACTTGCGTGCGCATGTTATTCAGCACTTT
TGATATATGCAANACTGGGAA
page-top