Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22156  (registered. 2007)
Contig Information
Length 1355 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0782700 [Oryza sativa (japonica cultivar-group)] >gi|75261388|sp|Q6K7E6|ERF1_ORYSJ RecName: Full=Ethylene-responsive transcription factor 1; AltName: Full=Ethylene-responsive element-binding factor 1; Short=EREBP-1; Short=OsEREBP1 >gi|47497482|dbj|BAD19536.1| putative transcription factor EREBP1 [Oryza sativa Japonica Group] >gi|113537850|dbj|BAF10233.1| Os02g0782700 [Oryza sativa (japonica cultivar-group)] >gi|125583912|gb|EAZ24843.1| hypothetical protein OsJ_008326 [Oryza sativa (japonica cultivar-group)] >gi|194396111|gb|ACF60473.1| EREBP transcription factor [Oryza sativa Japonica Group] >gi|215686718|dbj|BAG88971.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737331|dbj|BAG96260.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767498|dbj|BAG99726.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1083
Evalue 5.9409e-116
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22156
TTAACAGCCAAAACTAGAGGGAAAAAACAATCGAGTGCACAGATTAAAGCAAACTGGACACAGATCCATGCTGTTCACATTCAGAAATGGTAGCAACGAC
ATAAAAATTGACAAAAGATAAAGACAACGGTTCATCGGACTCATAAATGACAACGGTTCATCGACAGTCAACTAGGGAAAGGGTCGACTACAAAAGAGAC
TCAGGATGCGGCTTTTTTGCATCTAAGCTTGCACATAAGCATATTCTAACCAAAGGTGACAACGGGGTGCTTCCCAATCTCCCATAGTCTTATTCCCTTT
GTCCTGATGTACAGGGGTTTGAATCCCTCAGAAAATTTCGCCACAGATGGGCATGTCATCGAAGCTCCAAAGGTCCATGTTGCCAACGACATCCTGAGGC
ACATCAAAATTCAGAAGGCTATCAATCGGCTCATCCACGCCATCATCCAAAAGAAACCTCATCCAAGGTTCAAAATCAACAGCATTGTTCTCCATGACAG
GAGGCACCACTGAGTTGTAGGTGTTGGTCTGGACAGGCGCAGATTCAGCTCCTTCAGCAATCACCGCTGGGTTGTAGGTGTTACTCTGGAGAAGTGCAGT
TTCTGCTCCTTCAGCAATGGTAGAAATGGGAGCAATGGATGATATATCTGGAGTCTTGGTGTCATACTCCCAGCCCAAGTCAGAGCAGCCAAAGGAGTTG
CTTCCCTGGTCAGAGTACATATTCATAACAGGAGCTTCAACAGGTGCAGCAGAGTTAATTGCAGGAACAAATGGCACGTTATCAGGCTGAACAAGTGGCT
GCTTTGATGCAAAGTCAGCAGACGGGTAGACGAAAGCATTTGGGTTGGCAAGGTTGTTGACTGCTGGTATGACGGTAGGTTCCTGTGCTGCGCTTGACTT
GGAAACTTTAGGAGCAGCAGGGCAAGCACGGCGCTTCTGAGGAACTGTTGGTTCCTCTGGAAAGTTAACCTTGGCCTTCTTGCCACGGATCCTTCGTGCT
TCAACATCATAAGCTCTTGCAGCTTCTTCAGCACTGTTGAAGGTACCAAGCCAAACACGGACACCCTTGCTAGGATCTCTGATTTCAGCAGCCCACTTAC
CCCAGGGGCGCTGGCGGATACCCCTGAATTCGTTCTTTCTCTTCCTTTTTGCTGACCTTTGTGCAGGACCATCAAAACCAGCAGTGGTCATGGTGCTTAA
GTCATCTTGGGAGAGGGACCTCTTGACGGCGGCGAAGGGCTTGGTCTCGACGACCTCGTCGTCGCCGTCCTTCTCAGCCACCCCGCCGCGCCCGAGCTCC
TGGCCGGAGTCCCCGGAGTCGGCCTCGAACTCCTCGAAGTCGGCCTCGAAGTCCG
page-top