Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22151  (registered. 2007)
Contig Information
Length 1067 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_PCDAM Anther at meiosis 4
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0180200 [Oryza sativa (japonica cultivar-group)] >gi|50252089|dbj|BAD28019.1| unknown protein [Oryza sativa Japonica Group] >gi|113535621|dbj|BAF08004.1| Os02g0180200 [Oryza sativa (japonica cultivar-group)] >gi|125538336|gb|EAY84731.1| hypothetical protein OsI_06100 [Oryza sativa Indica Group] >gi|125581039|gb|EAZ21970.1| hypothetical protein OsJ_005453 [Oryza sativa (japonica cultivar-group)]
Score 815
Evalue 5.00402e-85
Total Hit Count 483
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22151
TTTTTTTTTTATTTTTTCAAGATATATTACACCATAGATTTAAGCCGTGTTTTAGGGACAATGTCGATATCCATAACCAAAGAGTACTCTATTCGCAACG
TAAACATATTTCACTCTGCAGTTATTAGTTTACAAATGTTCTCCAGGCTGCCGGTCTACTAGCACAAAAGCAACATCTGTTTGGTGTAAAACAACACATT
AGAACTAATGCTGTAACTATGATGTGCAAATGAGCAAGGAAACAGGTGTCCACAGTTACAGTTCATGCACAGCTAACCGATGCTGCGGAGGGGTTTAACC
ATGACCCGACACAGCTAGAATACAAAATTGAGAGACGCTTCTTTCATTATTGGAAAGCATTCAAGTACCAGGCCTTTTATCACTTGAGACCGTCGCCGAG
CCCTGCAGGCATTCCTATGCTCTGCGCTAGATCAGCCATCCTTTCCTTCATTGCCTGGACGCTCCTCTGGTGTGCATCCTTGTAGGCTTCATTGACCAGC
TCGGAGACTTTTTCAGCACCCAACTCCATTGCAGCTTCCGTGATTTCAACATTTATAGGTTGTTGGTTCCCAGATAGTGTAACCTTGATTAGTTCGCCTT
CACAATAACCCTCAATCTCAGTCGCTGCAAGCTCCTTTTGCACCCGCACAGCCTCCACTTGGACAACCATTTGGGCCTTCTTCACAGTTTCATAAAGGTT
TTGCATATTTCCAATGTTTCCAAAGATTCCTCCCTTTGATGGTGCCTCGTCACCATTCTCATCTTTCTCCTTCTTTCCTCCAAATAAACTGTATACCCGG
AACGATCTATTATTAGCTCTTTTCCAAGTGGAACATGGCAAACAGAATGCGCCTTGTACATTTATCCTAGTACGAGCTGGTCTGGAGGGGAGCGGCGAGA
AGGAGGACTTGAAGGCCACCGGGGAGAGAGCAGTGGAGGAAGCCATCGCGGGGAGTGAGACGAGGGCTCGCTCGCTCCAGGGGAGGGACGGTGGAGAAGA
AGGGGTGGCGAGAGAAGGGGAAAACCAGCTTGATTTTCGGGATAGAAGATATTGCGGCACGAGGCCT
page-top