Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22141  (registered. 2007)
Contig Information
Length 1549 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_RDr Root of dessiccated seed 4
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Phenylalanine ammonia-lyase >gi|1483610|emb|CAA68036.1| phenylalanine ammonia-lyase [Triticum aestivum]
Score 1733
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22141
TGAAATTTAACACACACTGCCTTTTTAACTTAGGTACATCATAAGAGTTCTACTGGCTACCCAACACTACCAAGTCATGCAATTGCAATCTTTGGCAATA
CATTGGCAGCTCTAGAAGAACATTGTAAATATCAACTTTCAGAATATACAATGAAAAAACAGTATTATCATCAGAGCCTTCAGAAATCTGAAGCACACTA
CTCTTCACTTTCTCGATCCTCTATTTAGCAGAGAGGCAAGGGCTCACCGTTCCACTCCTTGAGGCACTCAAGCAGCGCATCGATGTGCTTGCCCTGGTTC
ATGGCAATGAACACCTTGTCCACCTCTTCGCCAGGAGACCGCGTCTTCTCTCCGGTCAAGTACTCCGTTCCAAGCTCCTTGCGCACGAATCGGTAGAGTG
GGTACGACCGGCATTCGGCAATACGGTTTTGCTGTGCGGCAGTGCCATTCTCCACGGCGCTCCTGGCAGCTTCAACCTCCTTTGGCAGCACCGCACGAAG
CTCCTGCTCAAACGTGGCAAGCTTGGCAAACACTGACGTTTCCACGTCGCGCTCGGCCTCACCATTTGCCAAGGCATGCTCCACAAGAACTGCACGCATC
TTCTGCATCAGTGGGTAGTTGGCGCTACAAGGATCGTCTGCGTACGCAAACACCGCCTCACGGTCGATTGTGAGCAGAAGGTCCTTCTCGCAGAAGCGCG
CGTTATGGAGATGGCCATTGGTATCGGTGCTCAGTGTCTTCCTAGCTACAGTCTTCACACATCTCTTGATAGCATTCTTGACATTCTCCTCAAGGTGGCG
GAGGTCGATAGCCTGGCACAACGCAACCAAGAACGTCGAGGACATGAGCTTGAGTATGTCAATGGCCTCGGCGGTCTTCCTCGAGGAGATGAGACCAAGA
GAGTTGACATCTTGGTTGTGCTGCTCCGCACTTTGGACATGGTTGGTCACAGGGTTGCCCAAGAACTGAAGCTCGGAGCAGTAGGAGGCCATTGCAATCT
CGGCACCCTTGAAGCCATAGTCCAAGCTTGGGTTGCGCCCACCAGAGAGGTTGGAAGGAAGACCGTTGTTGTAGAAGTCGTTCACCAGCTCTGAGAATTG
AGCAAACATGAGCTTGCCAATCGCAGCAATGGCAAGCCTGGTGTTGTCCATGGACACACCGATGGGTGTGCCCTGGAAGTTGCCACCATGGATAGCTTTG
CCACGGGAGACGTCGATGAGTGGGTTGTCGTTGACGGAGTTGATTTCCCGCTCAATCGACTGAAGACGAGGCTAGGTAAAAAGGAGAGAAGAAACATTGT
GTATGGCCACCGTGTAAACAATAAGGAGCACCAAATGCTGTGAACGACTTGCGAGCAATTTGCTTTTGCTTCACCGGAGTTTGTGTAGATGCGAATTACG
TTTCAGGATCCCCTCCCTCTTTTTTTGCGACAGACAGGCAGACTTGTTTTTCCCCCAGGATTTTTACATTGTTTGGTCTCCAGCGCCAGGATGCACGCCA
TTATTTTTTCACCATGTGTACCATTATTTGTTGTATAAGAAGATTGAGC
page-top