Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22130  (registered. 2007)
Contig Information
Length 780 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative 60S ribosomal protein L39 [Oryza sativa Japonica Group]
Score 302
Evalue 9.05089e-26
Total Hit Count 222
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22130
TTTTTTTTTTAACAAGGGTGGCATATAGCAAAGGTTCTTTACTTGGCACAGCATGGTAACATGAGTACACCAGAGTACAAGCAATCCTCATGACATAGAC
GAAATTGATAACAGAGACAGCATCCTGGAATCACTTCCTAGCTTGCATAACAAACACTAAAACGTCCATAAAACAAAATGCAGATAAGTCTTGGAACCAT
GGCTCCCCCACGCGGCGGTCGGCAGGTACGGATCTAGAACCCGAGCTTGGTGCGGCGCCAGTGCCTGCGCTTCGCGTTGTACCTGATGGTGTTGTCGGTC
CGCATGCGGATCCAGTAGGGGATGGGGCGGTTCTGGCGCTGCTTCTTGGCCAGCTTCTGCTTGATGCGGAAGGTCTTGTGGGACGGCATCGTCGCGGCGG
AGACGAAGACGCGGCAGCGGCTCCTCGTGCCGAATTCGGCACGAGGTTTTTTTTTTGCAAGCTAAAGGCCAATATTTGATTATCTACTATACAAACTTTG
GGTATGAAAGTAGGACCCTCGTTTGANACCAAAGGATCTTCCATCATTTACTTCTAGCCTTTTGTATATACTGGGAGCAAAAAAACAANATCANATTCCA
TCAAAATCNCATGCAAGTTANCANACACCATAAACCACGTAATATGCTTCAGGAAAAAGTCAANANATTCAAATGTGCACACTACAAACTCCAGGCTGCA
CCAAANAGGATGAAGCCACTGAATGCCANTTCAAAACTGAAAGCTGCCACAAANACCAAATCATCAAGTAATATGCATCA
page-top