Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22116  (registered. 2007)
Contig Information
Length 1132 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_VSCB Liquid cultured tissue 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os11g0186200 [Oryza sativa (japonica cultivar-group)] >gi|62954909|gb|AAY23278.1| aldehyde dehydrogenase, putative [Oryza sativa (japonica cultivar-group)] >gi|108864076|gb|ABA91775.2| aldehyde dehydrogenase family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113644625|dbj|BAF27766.1| Os11g0186200 [Oryza sativa (japonica cultivar-group)] >gi|215737694|dbj|BAG96824.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737793|dbj|BAG96923.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218185391|gb|EEC67818.1| hypothetical protein OsI_35395 [Oryza sativa Indica Group]
Score 1276
Evalue 1.90981e-138
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22116
TTTTTTTTTTAAGCAGGGCGTAATCCTCTTCATCCTTCACGCTGGAGTAAGTAGCAAACCAGGTTTATTTATGTAAAATTAAATTACATCCAGAAATCCG
ATGATAGTCCCATATTTTACACCTGTTGAACACACTCGCGCACTGGCGCTTCACAGTGCAGAAGTGCACCACATCACCAGTCCTGCACATCACCCTCATG
AACATGAACAATCCTGCTATGCTGTACTGGAGAAGGGAGGGAACTCAACTCAGCTAACGCTTCTCCCTTGGGAACCCCAGGAGCGCAAGGATCAGCGCAA
AGAAGCTGCCCTTGATGAGGCCCCTCAAGATCCTCTGTTTCTCTGCCGTGTAGGGTGGGTACCTTGCGTTCGCCTCGCCACCGAACCCGCGGATCAGCAC
TGCCTTTCTGTGGGTGAAGCAGTCGAAGCTGAACTTGCCATGGTACGACCCCGTGCCGCTGTCGCCCACGCCACCGAACGGCAAATGTGGGTTCGTCAGG
TGTAGGGCGACGTCGTTGACGAGCATGCCTCCTGCCGAGACGTTTGAGACGAAATCTTGTTGCAGTTTCTTGTCCTTGGTGAAGAGGTAGGCCGCCAGTG
GCTTCGCCCCGGCGTTGATGTGTGTGATGCTTTCTTCAATCTTGTCGACCGTTATAATTGGAAGCATGGGGCCAAATATTTCCCCTGTCATAAGTTCTGT
ATCAAGAGGAACATCTACCAACACCGTAGGAGCTATTTTTAGTTGCTCCTGATCTGTCTGACCACCGAGCTGAATCTTGGTGGCAACTTCCTTGTCCTCT
ATCAACTTCGCTAATCGTTCGAAATGGCTAATACTCACAATACGAGACAGGTCCGCCGATTGCAACGGATCCTCCCCATAGAACCTTTCCAAGACTCTTT
TCAAAGAGTCGACCAGTTCTGTAACGAAAGCTTTTGTCGTTATGATGTAATCGGGAGCAATGCATGCCTGGCCATTGTTACAGCCCCATTTACCAACAGC
AATCCTCTTAGCAGCAACATGCAGATCGACGTTAGAGTCAACAATAACAGGGCATTTTCCACCGAGCTCCAGAGCAACAGGGGTTAGATGCTTCGCAGCT
GCTGCCAACACTACGCGGGCTACATTACCATT
page-top