Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22079  (registered. 2007)
Contig Information
Length 989 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 6
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VHS Shoot with heat shock treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative ABA-induced protein [Cynodon dactylon]
Score 856
Evalue 7.84397e-90
Total Hit Count 131
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22079
GATGCCGCTGCGCGCCACATGGTCCGGTACAACTTGTTGCATGAAGTTGAATGTTTGTGGAGACATAAAACAAAGCACTACTAAAGTCAAAACTTTTTAG
TAATCGAAAATGTCAACTGAAAACATCATATTTGGTAAACAAATGCGATATCTAGACAAACAGGCTTTGAATTCTCATTCCATAAAAGAACAAGCAAACA
CACGAAATCAAATCACAACATTAATTTACAGAACCATACTCGCAAGCACACCATAATTTACGCATACTTGCGCATAATCACAAATAAGAGGGTATTGGGA
TAGTTTTCATCATTTCTTCTTGGCAGATTCTTTAGCTTGCTTCCTCTCTTGCTCCAACTTCACAAACAGGCTGCCATCGTAGACCGCCCTGACGGTCTCC
TTGTGAAGAAATCCCTCCTTATCTTTGCACAGCGAGTAGAGAACCTTCCACTCTGTGAAGCCACCCACTCGTCCTTTCAAATCGTTCGGCTCCCTGTTTG
CTTGAAGCAACTCATTCAGTTCTTTGCCTGTCAGGGCATCAGGCCTGGTGTGAGCATGCTTTTTGAATATCTCTTCAAACTTTTCAGGAACAAACCTTCC
ATTGGCATCGTACACGCCCGAATCGCTCCCATGCTTGCCCTTGTGGATGTTCTTTACGTAGATCGGAAACTTGAAAGCACCAACCTTCATGTTCTCCGGT
ATGGTCTTGGGACCGAGCAGTCCGTTGATGAAGACGGCGCTGAAGGCGGACAGCGCGACGCCGCACCCGATCGCGCGGAACCCCTCGTAGGTCTCGGAGG
GGTGGATGACGCCGTCCTTGTTCCGGTCGAAGAAGGCGACGTGCTTCTGCAGCGGCGTCAGCTCGTGGTTGTACACGTCCGCCATGGAGGACGGCTCCTC
CTTCTCCTTGGGCTGCCCACCTGCGGTGACCGCGGACTTGGACGCCATGGATTCCAACGAGACGGGGGGAAAGGTTGCGCGGCACGAGG
page-top