Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22071  (registered. 2007)
Contig Information
Length 646 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative oxygen-evolving complex precursor [Triticum aestivum]
Score 538
Evalue 2.6463e-53
Total Hit Count 94
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22071
TTTTTTTTTTGACTGAATCTGCTTGTGATTTCACCTGTGAAAGACTCAATATAGAATCATACTTAGTGCTTGTTGACATATTATCAACAGGGAAGTTACA
TTGCCGGCTTCCAAATATGAACAAACATAAAAGGCCTGAAAGCAACACGGCCATTATGCGGATCCATCTAGCCTAGCTTGGCGAGGACATCGCCAAGAAC
GGTCTTGGTCTCTCCGTAGTACTTCTCGGCCTCGGTGGGGCTCTTGATCTTGGCTGCATGGTCAAGCCCGTCGAGGGTGGCGAAGAGCTTGCCGGTGAGG
TCCTTGAGGTCCTTCTTTTCCTCCTTGGTGGTCTTGGAGGAGATGACGGTCTTGAGGTCGTAGCGCAGGTAGGAGGCCCTCAGGCGGAGGTCGTTCATGA
CGTACGGCCATTGCTTCTTGTCGATGAGCGGCTTGAGGTTGAGGATGTCCTGGGCCGACTCCTTGGCCCGGACCGCCGCCTCCGCCGGTGGCAGCGGCTG
CAGGTAGAACCGGTTCTTCAGGGGCAGGTCGAAGTCCCTTGCCTCGTCGGAGTTGTCCGTTCCGGGGAGTCCACCGGAGAGCGGCGGCGGCGGGCCAACC
TTGATGGCCGCGACGGTGCCGGCGTGCACCACCTGAGCGAACGCGC
page-top