Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11721  (registered. 2012)
Contig Information
Length 168 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XE Seedling, infected with leaf rust 1
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig11721
TAGCCAAGCAGGTATTACATAAAATGAAACAGTCTAGCATAAGCTGCGCTGCTCTTTAACTAAAAAGGAAACAAGCAACTANNTTTATTGCAAACTCGGC
TGAGCACCCCAGGTTTGTGCGCCATGAAGTGCACTGGATAAGCCAACCGTATTATGGTTTGTCCGCTC
page-top