Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22027  (registered. 2007)
Contig Information
Length 2024 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_01543 [Oryza sativa Indica Group]
Score 1571
Evalue 0
Total Hit Count 84
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22027
CACATGAGACAAATTTGTATTAGTCAACAATGATACAAACTATTAACTGTTAGCTTCCGCATCTGCAAAATTACCCATTGGGAAGAAAGGAAACAGCTAC
ATTTGTAATCCTGATGTGTAAGTTCAAATTCTCCACACCTAATCAGGATCATATGTTTCAGGCTCTCTTTCTCAATATTGTCTTGCGTGGTTCCTTTCTG
CTCGGTGTGTTTCCTGAACCTAGGGAAGTCATTCCTACAGCGCTTTGGTACAAGTCCTTCAACCTTGGCATACTGATCACGACTGTAACAACAGAAACTC
CAACAATAAGAGGAAAAACTGGGGCTGGGGTCAGTTCCTGTTTGTGATGCCGCTCTTCCGTTTTATATTTAAGAGGACCAACATGAATCTGAGGTTGCTT
TTCTAGGTCAACTTCAACCAACTCAGATTCAAATATATGGGTATGTGATGGAAGGCCAGACCGAAGCTGAACAAAATGCTTTCCTTTGGGTAAATTTCTT
ACTTCGACGTGGTAGGAAAGAGGAACAGGAACTACAGATTCTATTCTAGAAGGGTCAACAGCTGATCTAATTTCAACAGATAAATGTGGCTGCAACATAT
CAATGTCATTTCCTTCCACGTGACAGCTCAAAATTGTTGCTTCTGGGCGTTCAAAAACCACAAAACCAATACCAGAGATGTCCTCCTCATCGACATCAAC
TGATACAGATTCTGGTGAAGCACGCTCAACTGCTGCCAACCTGAGATTATCTTTTGCAACTACTCTTATTGAGTAAGATGAGCCAGGGACAAGTCCTCTC
AAGCGGAACCTACCAAAAGAATCTGTAGTAGCTTCCTCATAATAACCTCTTGATTCAAAATCTAGCTTCAACAAAAAACACCTTCCTTTGGTTGGCCAGT
TAACAGTGTAACAGAACCCATGGCACTGAAGGCAACACGGGTTGCACGGAACTCAACCGCTCTAGACTCTCCAGAATTGAGATCAATAGCAACTGTTGAT
GGAGTAAATTTATATTCCTTAAGAAGAGCGCGGAGATAATAACTCCTAGGAAATAAGTTATCGAAGCTGAAAGTTCCACCAGAACCACTGACTGAGTTTT
TTCTGTAACCTCCTTCACCACTCAAGGATAATAATACTGCCGGTAACATCTCTGTATCATTTTCGCCATAAATATGAGCTAATATCTGACCAAGTTTCTG
ACAAGCAAAGCTGTATGGGCCAGTTTGCTTGAGATGATAGCCAGCCTTTGAGGCTTCGACTTCATATCCTATATCCTCATACAAGGGCCCTGCAAAGAAT
GACCCATCGGAATTTGTCTTTGTCTCTGTTGCTATATCACCTTTCTTCAGCATCGCATACTTGCTATTTCCAGCTGCCAGAATCATGATATGAACATCAG
GAGTTGCAGGTGACACTGATCCTTCAAGGTATAGACCCATTTTAGCAGTGATTGAAGGAACAGCATCTTGGCATCCGCTTGCAGACACTGAGAACTGATG
CCGTGATGGATAAAATAGGATCTTTTTCCTTCTAGTGCTGGAATCACGAGGGACAAAAATGAAGTCTTCCCCAAGATCAGTCCAAGTAGAGTACTCAAAG
ACAGTAATACCATTTTGATAACTCTTTGCAAAAACAGGCATGGTAGATATTTTGTCGATAGAGCTCCCATTACTCTTGAAGGCATCAACAACGATATCTT
CTAATAAATCAATCTCTTCCAGAGGGGAGCTTATGTCCACATGGATTTCACCTCTTACAAGATACTTCTTTGCACTGATGTGAACCAACACTGGGTTCTG
TGTATCAAACACAATAGGCGAGGTCCCAAAGGAAATGCAAGAATTAACTAAATAAAGCTCATGTTGCCCAGGAGTTTCGATGCAAATTCTTTGTGACCCT
TCCTTTATCAACAATTCAAGTTTAGAAGAGTCTGGTTGACGAATGTATGCTTCAGTGTCATGACTTGAGACTAGCTCTATCCAATAACCCTTTTGTACAA
ATACAATATTTGTCACATCATCAT
page-top