Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22017  (registered. 2007)
Contig Information
Length 1292 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 5
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0533700 [Oryza sativa (japonica cultivar-group)] >gi|42761395|dbj|BAD11663.1| cation exchanger-like protein [Oryza sativa Japonica Group] >gi|45735791|dbj|BAD13154.1| cation exchanger-like protein [Oryza sativa Japonica Group] >gi|113624316|dbj|BAF24261.1| Os08g0533700 [Oryza sativa (japonica cultivar-group)] >gi|125604138|gb|EAZ43463.1| hypothetical protein OsJ_026946 [Oryza sativa (japonica cultivar-group)] >gi|215707134|dbj|BAG93594.1| unnamed protein product [Oryza sativa Japonica Group]
Score 988
Evalue 5.74871e-105
Total Hit Count 476
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22017
AATCTTTCTTCAGCAAACTGCATAACCATGTTGAGTTGAGCAACAATGCTCCTCTGGAACACGGGTTCAAGTTTATCTTCATACAAGGACCGTTTACAAG
ACTTCACTACTATCTTAGCGGCCACTGGTGACACGCCATGGCGACCGACATCAGGTGATCCGTACGAGCAGAACCACCATGACAAACATGCAGGTCATTA
AAAAGATGAGCAACCACTGGAAGCAGCTCGTCTTGGAGGCCAGCGAGTAGACCTCCGAGGCTCGCGCCGTTGCACGGCCAGTACTCGCCAGGCTATGTTC
CACGGCTCTCTCCGTGGAATCGAGGATCTTCTCTGTATCTTGCACGGATTGGTTCATTAAAAGGCTACTCTCCTTCAGCTGGCGTGCTAAGTCAACCATT
TCGTCAGTCAGATCTTCTTGCAGCTTCCTATGCTTCTCAATATGAGCCTGAGCTTCTGCATCCAATTTAATAGGTGCTCCAGTGTCTCTTTCTTTTCTTT
CATGACTGCTTGGTCCAACCTCCATCTGAGCCGTCGATCTCCTCCGCAGTCCTGATGATAAGGATATTGGACTCCCGACCTTTTCTCTTTCATAAGAGCT
GTCTTGTTCTCTACTCTCATCAACCAGATTTTCATTTTCTGGCACTAGAGAAGCAAGCGTGGCAGCTAGTGCTTCAATCTTTTCTGAATACTCACTGAGC
TTAGCTTTTGAAACACTTGATATTCCTTCTGGTGTAATTTCAGCTCCAAGTTGCTCCAACAGCTCCCTGGCTGTGGTTATGTAATGGACAAGCTTAGCCT
GATTCTGCTGGCGGGGGGCCGCCTCAAGCAGCCTTCTCAAGTTAACTTCCACCTTGCTGAACACCATGACTAACTAATACCTTGTTGAGGTGCTGAACCG
TGGTGAGAAGTGAGCTGCCGAAGCCGGATTGAAGGAGCAGCTGGGAAGCAGAGCAGCCGGACTGGGACTTGACTCACGGGTAGAAGGGCTTGGCCGCAGG
GGATCTGGGCGTCGAGCTTGAGGGTTACAGGGCCACAGGGGTGTGGAGCTTGAGGGTCGCCGTCCGACTGAGAGCCCACGAGGGAAGCGTGTCGAGCTCG
AGCAGGAAGTGGCTGCCCTGCTGCCTCAACGAACGGGAAGTGAGCGGGGGCTACGCCATCCGGTGATCTCTCCTCTGCCTCTTCGTCCGGCCTCCGGCGC
CAGCCGCCAGCCGCCGGCCGCCAACCGAAGAGAAGGGGAGAGGATGGGAGGAGTGTGCCGATCTAGGGTTCGCCTGGACAAGCCTAAAATCT
page-top