Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22011  (registered. 2007)
Contig Information
Length 1422 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 3
Wh_RDr Root of dessiccated seed 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit mitochondrial aldehyde dehydrogenase [Secale cereale]
Score 1961
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22011
GCTTGTTCGGCTTATGCGGTACTATGCAGGCTGGACTGACAAGATCCATGGTCTCATCGTACCGGCTGATGGCCCTCACCATGTACAGGTGCTGCACGAG
CCGATTGGTGTCGTGGGTCAGATCATCCCGTGGAACTTCCCACTTTTGATGTATGGCTGGAAAGTTGGCCCTGCTTTGGCCTGTGGTAACACTATTGTTC
TCAAGACTGCTGAACAAACTCCTCTATCTGCCCTCTATGTTTCTAAGCTGTTGCATGAGGCTGGACTACCCGAAGGTGTCCTGAATATCGTATCTGGTTT
CGGTCCTACTGCTGGGGCTGCTCTTGCTAGCCACATGGATGTTGACAAGATTGCATTCACTGGATCAACCGATACTGGGAAAGTTATTCTTGAGCTATCT
GCACGGAGCAATCTTAAGCCAGTGACACTGGAGCTAGGAGGCAAATCTCCTTTTATCGTCATGGATGATGCGGATATTGACCAAGCCGTTGAGCTTGCGC
ATTTTGCCCTGTTTTTTAACCAGGGACAATGCTGTTGCGCTGGGTCTCGCACCTTCGTACATGAGCGTGTTTATGATGAGTTTGTTGAGAAGTCCAAGGC
TCGCGCTTTGAAGCGTGTAGTTGGTGATCCATTCAGGAAAGGTGTTGAGCAGGGTCCTCAGATTGATGACGAGCAATTCAAGAAGATCTTGCGGTACATT
AAGTCGGGTGTGGACAGTGGAGCCACCCTTGTGACGGGTGGTGACAAGTTGGGTGACAAAGGTTACTACATCCAGCCAACAATTTTCTCAGATGTGCAGG
ATGGCATGAAGATTGCCCAAGAGGAGATATTTGGGCCTGTTCAGTCAATCTTCAAGTTCAATGACCTCAACGAGGTGATCAAGAGGGCGAACGCAAGCCA
GTACGGATTGGCCGCAGGTGTTTTCACCAACAACCTGGACACGGCCAACACCTTGACGCGTGCCCTCAGGGCCGGGACTGTCTGGGTGAACTGCTTCGAC
ATCTTCGACGCGGCGATCCCCTTCGGCGGATACAAGATGAGCGGCATCGGTAGGGAGAAGGGCATTGACAGCCTGAAGAACTACCTACAAGTCAAGGCGG
TCGTCACCGCGCTTAAGAACCCCGCATGGTTGTGAGCATAGCGCACCTATGGTCCTCCTTGAGACTCCGGAGAACGTGAAGACTCGCGACAATTGAATGA
GAAGAGGAAGATGATGATGATGACACCAACGAGGATCACTAATAAGCCCCTGCCTTCATGGGCAGCCAGCCACCGTCTCTAATAAATATCATATGTGATT
TTCCTTTGTCAACCGTGGCAAGACATATATGTTGTAGCAACATTATGTTTATTATCGCCTGTTGGAGAAGTCTCTGGTTGCAGTAAATCTGTTTTTTTTT
CAGTTCTTCTACAAAAAAAAAA
page-top