Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22005  (registered. 2007)
Contig Information
Length 1551 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0512600 [Oryza sativa (japonica cultivar-group)] >gi|122222032|sp|Q0J4I1|CKB21_ORYSJ RecName: Full=Cyclin-dependent kinase B2-1; Short=CDKB2;1; Short=CDKB;2; AltName: Full=CDC2Os-3 >gi|113624189|dbj|BAF24134.1| Os08g0512600 [Oryza sativa (japonica cultivar-group)] >gi|218201442|gb|EEC83869.1| hypothetical protein OsI_29856 [Oryza sativa Indica Group]
Score 1474
Evalue 3.24621e-161
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22005
GTGACCCTTCAAATACAGTATAAAAAACTAGAGGACCATAGGCAATGTTTTTGAAGCAGAAGTAGTGCAAAAATACTAATCTAATTTGCAACAATCAGTT
GTAGCCCAAGTTAAATTACGCTCCATATCCAAGTCTCAGGGCACAAACAAAGCACGAGGACTTCTATAAGAGCATCGAGACGAAATTAGATAATCTTTCA
GTTATCCATCAGAAACAAAAATGAATGGCATACACTATAAATAGCAGCCAGAAAAAGAGGTAAAGCCTGATTTTGAAGCAGAAGTAGTGCTTCGGAAGAC
CAGTACTTAACGCCTGGCAAGAGGCGTTTAATTATGCATAACTCCAGAGTCACCGTCCATCACAACCATCAGTCAATGGGGCAAAACTAAATGGCAGCTG
GAATAACAGAGGTAAAGATGCCTGCCCTGGAAGCAAAAGATATGCTTCAGGACAAGCACAAATCACAAGAAATCCGCTTCTTGCTAGCCACGAAGACAGC
TTCAGTACAGCACCTTGTCCACATCATCGAAGTATGGGTGCTCCATGGCCTTCTTCGCAGAGATCCGCTTTGCCGGCTCATACTGCAGCATTTTCTCAAG
CAGATCAATACCATCGGCATCGAGACTAGGAATGACAGAAGACAGCTTTGAGACATTCCACTGAGGGTACTCATGCCAGTTCGGGAGTTTGCCTACTCCT
GGCCAGACATCCTCATTTGGAGTGCCCAGCAACTTGAAAATGTGCAGGAGCTGCTGCACCTCAGAGTCTCCAGGGAAAAGTGCCGTGGTAGTGATCAATT
CAGCAAATATGCAGCCCACAGACCACATGTCAACCGGCGTTGAGTAGTGTGTGGCGCCAAGAAGGACCTCCGGAGCTCTGTACCACAGAGTAAGGATCTC
GTGTGTGTACTTCTTGAGAGGAACCGTGAAGGCACGACTGAGCCCAAGATCGGCGATCTTGAGAGCCATGGTCTTGCGGTCCATGAGCAGGTTGTGTGGC
TTGAGGTCACGGTGCAGGACACCTCGTCCGTGGCAGAAAGCCACGCCCTTGCAGAGCTGGTACATCAAGATCTTGACGGTGTGGGCGGGGATCTTCTCGT
GGTTCTGGCGGTGGCCGCGGATGAACTTCTTGAGGTCGGTGTCCATGTACTCGAAGACGAGGTAGAGGATGGTCTGGCCCTCCTTGTTCTGGCCCTGCTT
GAGATCGAGCAGGCGCACGACGTGCGGGTCCTGCGACAGCATCCGCAGCAGCGAGACCTCCCTGAGCGCCGTGGGGGGCACGCCCTCGTCGTCCTCCGGG
AGGCGCGTCTTCTTGAGCGCCACGATCCGGCCCGTCGCCTTCTCCCGGGCCTTGTACACCTTCCCGTAGGTGCCCTCCCCGACCTTCTCCAGCTTCTCGT
AGAGGTCCATGGCGCGCAGCCCGCCGCCCGTGGTGGTCATCGGCGCCGCTGCCCCCTGGTTCTGGTGCTGGAGCATCGCCATCGTGCAGATCCGCTCTCC
CTCGGCCTCTTCCTCTCTGGTGGGCTGCCGTGCGAGATGCGTGATTTGGTG
page-top