Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21968  (registered. 2007)
Contig Information
Length 1930 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_KMP Shoot grown under continuous light 1
Wh_OKCS Seed DPA5 2
Wh_SHDr Shoot grown with dessication 3
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_20653 [Oryza sativa Indica Group]
Score 2436
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21968
GAATCAAGGTTATCAACCAAAAGGAAGCAGCTAGCAGCAAGCTTTTCAAAGATAAAGAGTTTAACTTGGAAAAATTGGGGATAGGTGGGTTAAGTTCTGA
ATTCACAGACATTTTCCGTANGGCATTTGCTTCAAGGGTGTTTCCTCCTCATGTTGTCAGCAAATTGGGCATTAAACACGTAAAGGGTATGTTGCTATAC
GGGCCTCCTGGTACTGGCAAGACCCTCATGGCCCGTCAGATTGGAAAACTGTTGAATGGAAAGGACCCGAAGATTGTGAATGGACCTGAAGTGTTGAGCA
AATTTGTTGGAGAAACAGAGAAGAATGTGAGAGATTTGTTTCTTGATGCTGAAAATGACCAGAAGGCGCAAGGTGATCATAGTGACCTCCATGTTATCAT
TTTTGATGAAATTGATGCTATCTGCAAGTCTAGAGGGTCTAGCAGAGATGGTACAGGCGTACATGATAGCATTGTAAACCAGCTGCTTACAAAGATAGAT
GGTGTTGAGGCGTTGAATAACGTGTTGCTTATTGGAATGACCAACCGTAAGGATTTACTTGACGAAGCTTTATTGAGACCAGGACGACTGGAAGTTCATA
TCGAGATAAACTTGCCTGACGAGAATGGTCGTTTGCAAATTCTTCAAATTCATACAAGCAAGATGAGGGAGAGCTCTTTCCTTTCTCCAGATGTTAATCT
TCAAGAGCTAGCTGCACGAACAAAGAACTACAGTGGAGCAGAGTTGGAAGGTGTTGTTAAAAGTGCAGTTTCATTTGCTTTGAACCGGCAGATAAGCATG
GATGATCTCACTAAACCTTTGGACGAGGAAAGCATTAAGGTTACTATGGATGATTTTGTGAATGGACTTCATGAAATTACTCCCGCATTTGGTGCTTCAA
CTGATGACCTCGAAAGATGCAGGTTACATGGTATTGTTGACTGTGGCAAGGCACACCAGCACATTTTTCAGAGAGCTATGCTTCTGGTGGAACAAGTTAA
AGTTAGCAGAGGTAGCCCACTTGTGACCTGTCTATTGCAAGGTTCTGCTGGAAGTGGTAAATCAGCTTTGGCCGCTACTGTTGGTATTGACAGTGATTTT
GCTTATGTCAAAATTATATCTGCGGAGACAATGATTGGTTTCAGTGAAAGCAGCAAGTGTGCACAGATTTGCAAGGTTTTTGAGGATGCTTACAAATCCC
AGTTCAGCATCATAATTCTTGACGACATTGAAAGGTTACTGGAGTTTGTTGCCATCGGACCACGTTTTTCAAATCTGATATCGCAAACTCTTATGGTCCT
CCTCAAGAGGGTTCCTCCTAAGGGCAAAAACTTGCTTGTTATTGGAACAACAAGTGAGACAACATTTCTAGACTCCATTGGTATGTCTGGTGTGTTCTCG
GTGACCTACGAGGTTCCCAAACTGACAAAGGAGGATGCTGCAAAGGTGTTGCGACATTTGAATGTGTTCGATGAAGCAGATGTTGAGACAGCAGCAGAAG
CGCTGGACGATATGCCGATCAAGAAGCTGTACACGCTTGTCGAGATGGCTGCGCAGGGGCCACAAGGGGGAAGCGCAGAAGCCATCTATGCCGGAGAGGA
AAAGATAGACCTCAACCATTTCTTTAGCATCTTGAGCGACATCATCCGCTACTGATCACACATACATTTGAGGACCCTAGGCTCCACTATAGGAATTTGT
TTACTCCAGTTTCCCCAGCTTGCTATCTTCACAGGGTAGAGTGGTTTGATCCCGAGTGGCCTTTTATTGTCACGGTTCGGCGAGAGTTGTGTCTTTGCTA
TGCTTCCGTCGATATAAATATTCTATTATCTGAAGCCTGAGGGCTTGTTTTGTTTGAGACCTAGGCGCCGTGCCTGAGAAATATTTACCTGGCCATGCTA
TTTGGTGAATGGTGTTGTTGAAAAAAAAAA
page-top