Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21865  (registered. 2007)
Contig Information
Length 833 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VSCB Liquid cultured tissue 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38995 [Oryza sativa Indica Group]
Score 619
Evalue 1.78217e-62
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21865
TTTTTTTTTTCAGGTAAAAGAACTTCATGAACTATTATTTGTTGGTGCATCTAACAACTCATTTTCCTTCACAGCTAATACATAGTAGTACAATACGTTT
TATTGCTCTTATTCCTGTTGAAGCTCCGCAGCTGCCCTCGAGCACAGTTCGAAAGTAGCTAGCTTGTCAACGGCTGCAATACGAGCAAGCCTGGTAGTGG
ATTAGTAGCCGGCGAAAAGACAGGATGATCACAGGTATGTAGGACATAGGCACTTGCTTATATGTCAGCTCCATCGCAGGTCCTACTCTTAGCGAGTAGC
CTTACTTTTGGCCTCGCTTAACATCTTCTTGATCTCACTGCTGTCAGGGTCGAGTCTCAGCGCCTCCTGGAACGCATCAACTGCCCTTTGGTGATCCTCC
ATGAAAATGAGAGCTGAGCCCTCTCGGTACCATGCCTTGGACCAACCAGGACGCAGCATTTTGCACCGTTGAGCGTCTGCCAGTGCTCTGTCCCCTTCTC
GCATGCGCAGCCAGCAGAGGCTCCGGTTAGCAAACAGGGTCGCATCAAGTGGGTCTATCTCCATCACCAGTCCATAGTAGTACATTGCTGTAAAGTAGTC
CTTCTTTGCAAATGCTTCCTTCCCTTGTGACTTCAAATCAGCTTTCCGTTCTTCTGCAGAAGCTCTATCCTGAACCCTGGTCTGTGGAGATTTCATAGTT
GTAATTATCCCATCAACACTCCAATCAGGCACAGATGGAATTGGGTTTGTCTTAGGAAACAGAAGCTCAACAAGTTCACGTTGACCACGGACTGCTGCTC
TCTTGATTGGAATATCCCCGTGCTGGTTAGGAA
page-top