Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21854  (registered. 2007)
Contig Information
Length 1631 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0529800 [Oryza sativa (japonica cultivar-group)] >gi|53793245|dbj|BAD54469.1| putative mlo2 protein [Oryza sativa Japonica Group] >gi|113595815|dbj|BAF19689.1| Os06g0529800 [Oryza sativa (japonica cultivar-group)]
Score 1665
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21854
ACTCCCCCAAACCCCAATCGCGCGAGCACGCACGCACGCACGCGAGTCCAACCCCTCTACCCCGCCTCGCACGAAACCCTAACCCTAGGTTGGCCATGGC
CGGCGATGGGACCGACGCCGCCTTCGAGGACGAGGTGGAGCCGACGGTCACCATCAGCGAGTACATGGACGGCATCGAGGCCGAGGAGCTGGAGGCGGAT
TTGGTGCTGGGCGGGGACGACGGCAACGAGTGCACCTACGGCGCCGGCTACCTGAAGCGCCAGGCCGTCTTCTCCTGCCTCACCTGCGTGCCCGACGGCG
TCGCCGGGGTCTGCACCGCCTGCTGCCTCGCCTGCCACGACGGCCACGAGGTTGTTGAACTTTGGACGAAGCGAAATTTTCGTTGTGACTGTGGCAACTC
AAAGTTTGGAGGTCACCTCTGCAAACTTAGCCCTGAGAAAGACCCTGAAAATCCAGCAAATTCTTATAATCAGAACTTCAAGGGTTCCTACTGCACATGC
AGTAGGCCCTATCCTGATCCAGAAGCCAAGGAGCAAGTTGAAATGATACAGTGCTGTATCTGCGAGGACTGGTTTCATGAAGATCATATTGGGCTTGACT
CTTTGGAGAAGATACCAAGAGATGAGGAAGGGGAGCCACTGTATGAAGAATTCATATGCCATCAATGCTCGCCTGTTTGTTATTTCTTGAAACTCTATCC
TGATACGATCTGGGCTTCTAGTAAGCAGAGTTCTGCATCAGAAGCTGTTACTGCTGATTCAAATGGTATGGAAGGAGGTTCTTCAGGTCATGCTGACACT
GAGAAAAATGAAAACGGTGCTCCTGTAGACCGTCAAAGCATTGAAAATACCTCTGTCGAGGAGAACTGTACAAAAGACATTGCAGCTTCAGATAAGTCCA
TTTTGGGTGACAATTCAGGTGGCAACTGTAAGATAGGAGTGGATATAAATACAACATCAGCTGATTCAGAGAAAACTATGCCCTTTTTCATGTCAAAAGG
CTGGAGAGAGACCCTGTGTAAATGTGGGACATGCACCAACTTCTATGCGCAACGAGGCATTGCACATCTTACTGATAAGGAGGACTCTATTGAGGAATAT
GAGAAGATAGCGAAGCAGAAAAGGGAGAAGAAGTTGGAGCAGCAGGAAGGAGCTGAAGCTAACTTCATCAATTCACTTAACCATGTTCAGAAGATAGAGA
TTCTGAGTGGCATCAATGACATGAAAAATGAGTTTCAATCCTTTATGGAATCCTTTGATCCATCAAAACCAGTTACATCTGATGATGTAAAATCTATTTT
CGAGAATCTTGCTAGGAAGAAGCAGAGGTTATCTTGAGCTTCAATTGCTTCAGGTCTTGCTTGAGCGGGTGAGCCCAATGCCCTGCTGCTGCTACGCTGA
AATTTCCAACTGTTATCTGGCCACCGTCTTGTGTGGGCACTGTTAACTTATGCTGTGGCCACCACGGCGTGTTTATCTACTGTACTGTAATGCTAGCTTC
GTCGTAGTTGTGCTAGAGGTTTCAAAGTCGGCTCGTGGTAGTGTTCCGAGCGACCGGTGGAGTGAACTGCATGTTTGTTCCCTTGGATCAAAACTCTGTG
GTGATTCCCATTACCCNNAAATGTGTTCTCC
page-top