Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21851  (registered. 2007)
Contig Information
Length 944 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 11
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 27K protein [Triticum aestivum]
Score 1026
Evalue 1.40269e-109
Total Hit Count 244
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21851
ACTTTCTATACTGGTTCTTTTTTTTTTCAACANAGCATGTACTCCAGGATCCAGGTATTGATTTCACATGTTCAACCCAACAAACCAGATCAATCTAAGA
GCACAACCACTCGATTTATTAACCTTAACAGAGAGATTGAACTGCCCTATGTTCAGATGTATGATCCCCAAAAGGAAACATAACTTATCAATTATTATTA
TCACCATCCGGCAGGACCATCCTAATGTTGCCGATGGCATCATCATCGGCACGATCAAAGTGGGCCGTATACATTGTTGTCTGCCTCCAGGCCCAGGCTT
CGACACGCCTCGAGGAGGGGATAGCCCTTGTACGCCTTGCAGACGTAAGCTTTGAAGTTCCCGTAATCGTTATAGAGCGGCTTGCCGTCGACCACCACCC
ATGGAACGAACTGGTGAGGAGGCACGAGCGCAGCTGTCTGTTTCCCATACTCGAGCGAAAGATTGTGGCCACGCTCGCCCTTGTAGCACTCCGTGACTGG
CCTCGGGTCAAGCCCCTGTTTCTGGAAGCACGACTCCCACTCCCGGTGCTTGTTCTTCATCACTAGGTCCGACACGCAGTAAATGAAGCCGAGGTGCACT
TTCACGTCCGGCCAGGCGTCGATGGCGCAAGCCTCCACGGTGTTGAGAAGGCATTCCTCGGGGCCATGCTGACATGTGATGGCGCCGTGCGCGTTGACCT
TGGCGTTGCCGTAGGGGACGAGGGTGAGGTCCGCGGCGTCGAGCAGGCCGTCCCTGTAGGCCTTCAAGAGGTGGTTCGCCACGAAGCGGACCGAGTAGGG
GCACAGGGATTCGTAGTAGATTGCCACGTGCACCTTCTCGCTGCCACTGCCAGTCGCGACGTCGCCGGCGGTCGCCGCGGAGGTGGTGGAAAGCAGCTGG
AGGAGCGCTGCAAGGAGCAGGAGATGGTGGAGGCCGCGCGCCAT
page-top