Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21834  (registered. 2007)
Contig Information
Length 1446 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_KMP Shoot grown under continuous light 1
Wh_PCDAM Anther at meiosis 4
Wh_V4816 Shoot grown under cold condition for 16days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown protein [Oryza sativa Japonica Group] >gi|53793536|dbj|BAD52985.1| unknown protein [Oryza sativa Japonica Group] >gi|215695282|dbj|BAG90473.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215736840|dbj|BAG95769.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1173
Evalue 2.36661e-126
Total Hit Count 15
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21834
AGCTCTGGTAGGACAAAAAAATGCAAGGCACAATACCCATCCATTGTAATTACGAACTAAAAGGTAGCCAAGATTCATTAATTCAAGATGGTACCGTGGG
ATAACAGGAAAGGTACTCTTCTATGACAGAAGTCTTGGAAGCAAATCTACATGTTGAAAGTCTCTAATTGCATATAACAAGGAACATGACATAGCTCATG
GCATCACGCGCCAAGTTAGGTTAGCTACCAGTTACTACTATATCCGTAGGCCTGCTGGAGTCGGACCGCAGGAACCCGCTTCAACTCATCATCATCATCG
AGCAGGAACCATACGAGATACTACTACTTCATGACATCATTAAGAGGCGGAAACCAAAACAACAACAGTCTTGCAGACTCCAGAAAGGCACTTGTCCAGT
GAACTCTTCAAAACGATTCTCCTCAAGTAAGCATTAGTGAGTGATTTCCTTCTACCCATATCAAGCTGTTTCTTCCATCTCGTCATCAGACTGTGGATTC
TCCACCTCGCTGCCACTGCTCATGCCATTGGTAGCAGCAGACAAGAAGTAATCCTTAACCGAGCTGTCTTCAGCCTTGTACTTCACAAACTTCACAACTG
CTGCGTCTTCACTTCCACATTCCTTCCTTTTCCTTATGCCATTCGCCGTCACCTTCATGGACTGAGCGGCAGCCATGAAAGCATTATCAGCTGTCTCCAT
CTCCACGGCTTCTTCATCCTCCCCACCTTCTGTGTGCATACCCTCCTGGTGACTCTGCTTGTCAATGAAGAAAAGGTCGGCGTCTGAGTGACCCATCCTG
CTCTGATAGTGATAGTCATTCTTGGCATCATCATGCATCAGCCTCTCCCTGATCCTTGAACAGTTCTCTCCAAACACTGTGAGCCCCTTGTCTTCGAGAT
CTACAAGCCACTTCAGAAAAGCTTGAGGTGTGATAGCAACTGGTTTGCCGAGTTGGTCAGTGCCAGCTTGACGAGCAGCCCACCTAGCCAGGTAAACGGG
AATATTTGAAGTTGAGAAGGCGTTGATAAACGACATTGCTCTCCCTTGATCTCCTTTGGCCCTGGCATCATTGATGGCATCAAGAGTTATAACCAATCTT
GACACAAAAATAGGCAAAAGAGAACTATCAGCTTGATCAACTTCAGCTCCATTGAGGAATGAATAATCCACCAAGATCAGAGCATCATAAAGGACATCTC
TCACCAAGATCTCATCATCAGCACTCAGTAGTGAATAAACAGGCAGCGGAGGGTTCACAAGCATGTTCAGCAGGACTCCGAAGAATTGCTGGTTCTGGAA
GACCGAGATAGAGCTAACCGCCCAGATCCTTAGCTCCTTCTGCAGCTCAGAACGTGGCACCCCAGCCACACCCTGCACCTTGAGGCAGAGCCTGAGCAGG
AAGGCCTCCGCCACCACCACACCGGCGAGGAAAGTGACGCTGCAGC
page-top