Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21795  (registered. 2007)
Contig Information
Length 1516 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_OKCS Seed DPA5 6
Wh_SHC Shoot grown with cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VSCB Liquid cultured tissue 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0180800 [Oryza sativa (japonica cultivar-group)] >gi|13122421|dbj|BAB32902.1| putative heat shock protein [Oryza sativa Japonica Group] >gi|13161454|dbj|BAB33024.1| putative heat shock protein [Oryza sativa Japonica Group] >gi|113531741|dbj|BAF04124.1| Os01g0180800 [Oryza sativa (japonica cultivar-group)] >gi|125569279|gb|EAZ10794.1| hypothetical protein OsJ_000619 [Oryza sativa (japonica cultivar-group)]
Score 1121
Evalue 2.71223e-120
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21795
TTTTGAAGAAAGCTCTTAATAATAATATTGTTTCCGTAGTGACCAAAAATTTCTGAATCGCTATGGGCCACCGTAGATAAAAATTACAACGTTATGGACC
ATCGTCATTAAAAAAATACACTGGAGACCATGGGTCACCAAAACCTCGACGAATGCCCTTACCCTGCATGCATCTGCCAAACGTCGTCAAAGAAAAGACC
GCTTTTGAAGGGACAAAGACGTCTAGAAACACTGCAGAACTCTCCATGTTCTACTCATATCCTCACAACGTATGAAAACAACCATTCCTGCTAGTCTATT
GCCCTAGCAGGCAAAAAGCACAAGAGAACCCAACCGATCATGGACGTAAAATCTCCCTGGTCGACAGTTCTTAAACCTGGGAAGGATCATCCTTATCAGT
GTCCATTTGCTCAGCCGCATGCTCATCCTGAGCACCGTCGCTAGCTGGCTCAGCGGACTCGGCTCCATTTGATTGTTGTTCCGGTGTATGAGCCTCGGGT
GATGGGGTTTCTGCTGGTGGCGGGGTCTGGGGCTTTGGCGCTGGCCTTGGTTTGGTCATGATGGGTTTGCAGAACCTGTCAAGCGCTTCAGCCTTCTTCT
TTATGTCAGAAACAAGTAGGACGGGATTAGCATGCTTCGGTAGAGCATCTTGCTGCTGCTTTTTCTCCATTAGCCAGGTCTCTGCGGCCGAGCACTCATT
AACGACCTTTTGTTTCTCTGATATGTCTATGTGATCAAACTTTTGGTCAGCAGACAATGCAGCCTCTCTAAAACTGCGGATGCAGTACACCAATTGCTCA
AGAGCTGGACCTCTTTCTGTCCACTCTTTGTAGCGCATTTCGATAGGACCACCAAGCCTTTTCAGTTCTTCTAGTTTTGCAACATAGACTCCCTTGGTCT
CATCCTCACCATCTTCATACAGCCAATCCTCAACCTCCTGAAGTTTAGCCATCAACCCTTCTATATCCTCCAACATGACAAAATCATTGTACTTCTCATG
AATCTTGTTACGCATGTCATAAACATAAGCCTCGACTGAATTTTTCTTGTCCTTGGTTTCTTCCATCACTCTGTCCTGAAGAGCCATTTCATATTCTTTC
TCAACAGCTTTCTCTAGCTCAACAGTGCCCATCGCCCCATACACCATTTCGGCAACTGGAACATTTGTTTTCTTAACTTTCTTTTTTGATGGCTCAACCT
TTGTGTCAGTATCCATTGGAACAGTTTTTTCCTCAGAATCTTGTGCCCCGTTTTCAGCAGCACCCTCAGCAGGATCAGCAGCTCCTTTAGGTTCCTGCGT
ATGGTCACCAGCACTAGACGCAGGGTCCTGCGGTGCATCATCTGTCTCCATTCTAGTAGCATCCTTTGGCACCTCACTCGTAGATGAAACCGGAACTTCC
ACTTCCTCCTCTTCCAGCATCGTTGCTGATTCAAGAGACACTATCCCATGGATGTTGAGGCGAACTTTCACTTTCAGTTTAGCCTTCTCACCTTTGCTGG
ATGGAAAGGGCCGATC
page-top