Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21791  (registered. 2007)
Contig Information
Length 1073 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 2
Wh_SHDr Shoot grown with dessication 2
Wh_VHS Shoot with heat shock treatment 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit HSP70 [Triticum aestivum]
Score 1640
Evalue 1.09408e-180
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21791
AGAGAGGCAAAGCAAATCGCACCAGGCGAAACACAGAGAGCGCCGCCGTTACCGTCTTCCGGCGAACCCCCAAAGCGAGCGAGCGATTCCAAGGAGAGGA
GAGGAGGCGGAGATGGCCAAGGGCGAGGGGCCGGCGATCGGCATCGACCTCGGGACGACCTACTCCTGCGTCGGCGTGTGGCAGCATGACCGCGTCGAGA
TCATCGCCAACGACCAGGGCAACCGCACCACGCCCTCCTACGTCGCCTTCACCGACACCGAGCGCCTCATCGGCGACGCCGCCAAGAACCAGGTCGCCAT
GAACCCCACCAACACCGTCTTCGATGCGAAGCGGCTGATTGGCAGGAGGTTCTCTGATCCCTCCGTGCAGAGTGACATGAAGCTGTGGCCCTTCAAGGTC
ATCCCTGGCCCGGCAGACAAGCCCATGATCGTCGTCAACTACAAGGGCGAGGAGAAACAGTTCGCAGCGGAGGAGATCTCCTCCATGGTGCTCATCAAGA
TGAGGGAGATTGCTGAGGCCTTCCTCGGCAACTCTGTCAAGAACGCCGTGGTCACCGTCCCGGCCTACTTCAACGACTCCCAGCGCCAGGCCACCAAGGA
CGCCGGTGCTATCGCCGGGCTGAACGTGCTGCGCATCATCAACGAGCCCACTGCTGCTGCCATCGCCTATGGCCTTGACAAGAAGGCGACCAGCACTGGC
GAGAAGAACGTCCTCATCTTTGACCTTGGTGGTGGCACCTTCGATGTGTCTCTGCTGACCATCGAGGAGGGCATCTTCGAGGTGAAGGCCACCGCCGGTG
ACACTCACCTGGGTGGAGAGGACTTCGACAACCGCATGGTGAACCACTTCGTCCAGGAGTTCAAGCGCAAGCACAAGAAGGACATCACCGGCAACCCCCG
CGCTCTGCGTCGTCTCCGGACGGCGTGCGAACGTGCCAAGCGCACGCTGTCGTCGACGGCCCAGACCACCATCGAGATCGACTCGCTGTACGAGGGTGTG
GACTTCTACACCACCATCACCCGGGCTCGCTTTGAGGAGCTCAACATGGACCTCTTCCGCAAGTGCATGGAGC
page-top