Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21741  (registered. 2007)
Contig Information
Length 1110 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VABA Shoot with ABA treatment 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_03330 [Oryza sativa Indica Group]
Score 1147
Evalue 1.6929e-123
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21741
TCAGCACCGAATTGAATATTTTGAAGAGAAGGTTAAAATGATACACATTTCAAATAGCTATGTATATTTTTACATGAAATAGCTGTGTATATTATGAACG
TAAGAATCTTGCTCGAAAATGGTCTTTCGGAACCGTTGAACACAGAAGGCAGGACTGTCGGTATTTGTGTACAGGTACACTTGTATACTGTATACTTTGG
CATGGATGCTAAGCCTTTAGTGCAGGCAGGATGCACCTGACAGGATGAAGGTCAGGCTCATGTCCATTTTTACAGATTATAGCACTAGACCTAGTAAATT
GCACGCTATGCTTGACAAAAATGACTGGCTATGGGATGAAAAAATATGGTAGCTATTCTACACAAGGTTCTGTAAGACTATATTTACAGAGACAAAAACT
AAAAAAGAAAGAATATTCCCCTCGCTAGTTTGGGGTAGAACAATCTGCCGTATCAGTTTTGATAACTCTGGTATTGTAAGAACCACAGGAGACGCATTTG
TGGTACAGCCAATGAAACTGAGATCTCCCTTTTCTTTCACAGTCATTACAAAGAATGTCCTGACACCTCTCGCGGTATTCCTCGGGAAGCTCTTCAGCAG
CCAACAACGCATCAAGCATGCCAAAGTACACCGCCATATCTCCCAAGGATTTGCAGCAGATAGGACAAGTGTAGTGACTGCAAGTGTATGCCTGAAAGCA
AGCTGAATGCATGAAGTGACCACAAGGAAGAGCTCTAACTGCCGCGCTTGATGTGAATAGGAAGTCACAGCAGATTGGACAGTTTGTCTCTAGCCCCTTC
TCCCGACATTTGTGTTCTGTTAGTTTCATTCCAAGGCAGCAATTGCACTTCATGCAATGGAAGAAATCAACACCAAGACCTTTACCAAGACGACACAGAT
TACAAAACGGACAATGGTAGACAGTCCTTTCGTCATCAAAAAATTTGCAGATATTACAGTAATACTTTGCCATGGATAGTCCATTGCAAGACGGAGTTTG
GCAATTCGGACCGACAGGTTGAACCTTCAGGCATACCATGCACATCATCTCCTGTGTTGCTTTCCTACAGGCAGAAGTAATGTTGGCACATTTACATTTG
ATCCTCGTGC
page-top