Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21730  (registered. 2007)
Contig Information
Length 1453 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_RDr Root of dessiccated seed 3
Wh_SHDr Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit protein phosphatase 2C [Triticum monococcum]
Score 1724
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21730
GGCGGCTTCTGCGGCCACCGTCGAGGCGGAGGCGAGGGTCGCGGCCGGGGGGAGGAGCGTCTTCGCTGTCGAATGCGTTCCACTCTGGGGGTTTACATCA
ATTTGCGGCCGCCGCCCGGAGATGGAGGATGCGGTCATCGCTGTGCCGCGATTCTTCGGCTTGCCCCTCTGGATGCTCACGGGCAACAATATGGTCGATG
GACTCGATCCCATCTCCTTCCGCCTCCCCGCGCACTTTTTTGGTGTATATGATGGCCACGGCGGTGCACAGGTAACCCCACCATTAATGACACCTATCAA
CTGCCTACTGTATGACCTTGCCAGTCTCTGCCTCAATCCCAAGTGAAACTACAACTTTGTTAGATTTTGCGTCATGCCTGTGCAGGTAGCAGATTACTGT
CGGGATCGGCTCCACGCAGCGCTGGTGGAGGAGCTGAGCAGGATAGAAGGGTCCGTGTCTGGTGCTAACCTGGGAGCTGTGGAGTTTAAGAAGCAGTGGG
AAAAGGCGTTTGTGGATTGCTTCTCAAGGGTGGATGATGAGATAGCTGGTAAGGCGACCAGGGGAGGAGGGGGAAACGTGGACACAAGCAGTGTCACTGC
AATGGCCATTGCAGATCCTGTAGCACCTGAGACCGTCGGTTCAACGGCGGTGGTCGCTGTCATCTGCTCATCTCATATCATTGTCTCAAATTGTGGAGAC
TCGAGGGCAGTGCTCTGCCGTGGAAAGCAACCCGTGCCGTTGTCAGTGGATCATAAACCTAATAGGGAGGATGAGTACGCAAGGATTGAGGCAGAGGGTG
GCAAGGTCATACAGTGGAATGGCTACCGAGTTTTCGGTGTCCTTGCCATGTCGCGATCAATTGGTGACAGATATCTGAAACCATGGATAATTCCTGTCCC
AGAGGTCACAATTGTTCCTCGGGCGAAGGATGATGAGTGCCTTATTCTTGCCAGTGATGGCCTCTGGGATGTACTGTCGAATGAAGAGGTATGCGATGTT
GCCCGCAAGCGAATACTCTTATGGCATAAAAAGAACGGGGTAAACTTATCATCGGCCCAACGTAGCGGTGACTCCCCAGATCCAGCGGCTCAAGCAGCTG
CTGAATGCTTGTCGAAGCTTGCTCTCCAGAAGGGGAGCAAGGACAACATCACGGTTATTGTGGTAGACCTCAAGGCGCAGAGGAAGTTCAAGAGCAAAAC
TTAAGTCATCTTGCTTGATGGACAGCCTCTATGACAAATTCCTAGGAATCTATATAGATTTGGAGAATCCAAATTCGATCAGTTTAGACTGTTGTGTTAG
TACATTACTTAGCCCAGTTCGTTCTTTTCTTCCTTTTCACCATTTGGGCTGCCAAGGGCTGTATTCCTGTATACAGTACAGATTACGAAATTCCGCATCA
GGGTTTATGTTTCCTGATGGCGTGGGTGATCCTGTTTTCTGTTAAAAAAAAAA
page-top