Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21698  (registered. 2007)
Contig Information
Length 542 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_PCDAM Anther at meiosis 2
Wh_SHDr Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PAS2 [Zea mays]
Score 531
Evalue 1.10489e-52
Total Hit Count 301
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21698
TTTTTTTTTTCAGCAACAACCACATTCACATGACACAGAGTTTAATAATCTAGTGCCCAACAAGATCAGACTTTTGATTTGCTGACGTAGATGAGAAGCA
CAATGATGTGTCACCGAATTTTGTAAGACATATCGATAAGATTTACGCGGTCTTTGACTTTGCAAGCGCCTTCTTACGCTGCCCAAGCATGTAGGTGTAC
ATATGTGGGCTTCCTGGGACGTAAACTAGGAGTACCAGGATTGATGCATAGAAGTAATCAAATGAATAGTTCCATTTGTTGGGCATTCTGATGCAGTACT
TCTCTGATGCCTTGATGAACTGCAATGCAATATATATCAAACCAACCTCGCTGCTGATGCCGGTTGGGTACATGACTAGGAATGAGCTATACCTAAGCCA
TAGAAGCGATGATGGGGCAGATCCAAACAGCTCTTTCGTGCCGAAAAAAGAGTACCTAATAATCTCGGTGATGGACCAGCTGATGACCAGGGAGCTCACC
AGGATGTGTGTCCTGGTCTCGGGGAAGCTCCAGAGGATGCCC
page-top