Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21694  (registered. 2007)
Contig Information
Length 1581 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_22102 [Oryza sativa Indica Group]
Score 1049
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21694
TTTTTTTTTTGAAACAAAAATAACATATGTTTTATTGAGAAAACAACGACACTTGTTACAACAAAGGCTATATGAGGGACAGGTTACAAATATACATCCA
GCTCAAGCCGCCAGTTTGGCCAAAATCACCATATCTAAGATCTTGACCTCATAGGTGTCGTCGAGCTTCACAATGCCATCAGAACCGTCTATTCCTATAA
GTTTTCCAACAAATCCGCGGAAGGTACCATTCATGATCTTGATCCTGTCACTCTTCTTTGGTCTGATGACCTCGAGCTCAGTCGGAAGGACCGTCACAAT
GTCTCCGTTGCCTGACGACCCAAGTGCCACACGGCAAGTTCCATCCCCAAGCACTTCCCTGACCACACCAGGTCCTTCATCACCTGCCGCCAAGACATTA
ACTAACACATCTGGCAATGCCCAGTTAACTTCGCCCTCGCCACCTATTACAGGAGACATTATATCCATTCCAGCATTGCCTGGAGTCATTGGTTGACCAC
CAGGTGTACCAGGAAGGTACGCAGCAGAATTTGGTGTCATTGGCTGACCAACAGGTGTGGAAGGCACATATGGGCTTGGAGCATTCGCATAATTGCCCTC
TCTAGGAGTTGGGACGTCATTATAACTAACTCCTGGAGTATTTGCCCACCCTGATCCAGGTGTTGGGGCTTCATATGGCCGAGCTGGTGGTGTTCCTGGC
TGGTAAGCTGGACTGCTTCCCCAAGTATCAGGATTTCCATCTTCCCAATTATCTCTTGGAGGACTCATAGGAGCCCAGGCCCTACTACGCATCGGGGGTT
CGCATTCCATCATGTATCGGTGTTGCTCCAGGGTCCCGCATTGGAGTCTGAAAAGGATGTAGTGGCGTCCTAGACGGGTGCATTGGTGTTTCACTACCCA
ACGAGAATCGGGGTTCACGGAATGGTGTTGCAACAGTAGGTGTGTCGGCGATATCATCCCTCTTAACTGTGACAATCTTCATTAACGAATCAAGCTCCAC
ACGCACAAGCACCCCAGTCACCTCTTTAACGCGGCCACGGTACCCTTTGTAAGGACCAGATTTAATTTTGATACACTTGCCAACCAAGGCGTCATGTCCT
CTTCCACCACGACCACCTCCTCCAAATCTTCCACCATAGTTCATTTGTGGTCCTCTTGGGGGCAGCCTTCCTGGAGACTGCAAAATGCTTGCCGGGGATC
TCAAAGCACCCATCCTAGCATCTGCAGCATCCATACCATTTCCACGACGGCCACCAGTCGATCCACCGACAAGAATGCACGATTGTGCTTTTGCACAAAT
GAAGCCTGCATGTTCAAGGTGGTGCCTATCATATATGAACAATATCCCCTTATGTATGTGTTCCACAGGTCCTTGTGTTCCCTTACATGCTCCCTCAACA
ACTCTGACAACATCCTTGGTTGCGACCATATTATTAAACTTATCTTTCGCTGATGTACGCCGATCAATCTTGCTTTTTATTTCTCTTAATTTTACAAGCA
CCACTTCAGGTCTATCTGGCACTCCTTTCAGAACCTGGAATGCTTCAGTTTCCACTCTTATAATAACCCCAAATGACAAGT
page-top