Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21692  (registered. 2007)
Contig Information
Length 1622 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0920400 [Oryza sativa (japonica cultivar-group)] >gi|57899424|dbj|BAD88362.1| putative dynamin like protein 2a [Oryza sativa Japonica Group] >gi|57899854|dbj|BAD87638.1| putative dynamin like protein 2a [Oryza sativa Japonica Group] >gi|113534751|dbj|BAF07134.1| Os01g0920400 [Oryza sativa (japonica cultivar-group)]
Score 1512
Evalue 1.35127e-165
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21692
TTTTTTTTTTCATGTAGCACAACCTCTTCGCATCTTAACACGAACCATGTCAGACTTATCACGGCAAAACCAACCGTGTTTAGATACAAGTACTTGGCAC
TAAAACTAAAGGTTCCCATAGCATCTTCCATGGGTTTAAAACAAAAATCTATACCCATCACCGGTTTCATTTTAAGTCGAAATGATTGGGCAGTGATATA
CTGTACAAGAGGGCACATGGCAAAAATTTGGCACCACGCCAATGCTTTCGTTGGGCGCAACACTAAAAAGAATAGCAATGGCTAGAGAAAAAACATATAT
CTATTGGGTACCGAACTGACAAACCCAAAGGCGGAATGATGTGTTGCTACCAGCACATCCGCTGGCTCAATCACTACTAATCCGGGGGATGATCGTGAAA
GGCAATATCAAAACCCATTGCCACTGAAAGGTTGTTGCTGCTCCCCAGAGTGGCTTGATTTCCTAGGCCTTGTTTGCTTCGGAGTCGAATATGGTGAGCT
TCCATCGTAAACCCCATGGACCCGTGGTAGACCCGTCGCATCAGAATCCAGGGAATAGCCCCTCTCGACTGTCTCCGCTTCAAGCGGTATCTCGTCCAAA
GTTTTGTAGGCTTGCTGAAGGACCTTAAGAGTATCGCGTATCTGCCTCCTCTTTGTGGTTATTTCGTCAGGTTCTCTGAGAATGTCCCCAAAGAGCTCTT
CTCTATAAAGGGTAGTTATAAGGAAATTATGCAGCTCCCTTTTCGTGTGATTAACCAGAAAATGCATAATTGCTTTTGGTACAAAATCCTCGACATTTTT
CCTGACTATATTGTAGTATGACTGCAGCAGCAATTTTGTGATTGCTATTTCAAGGTCCTCCTGCTCAGAATGACTTTCTGAAGGCTTGAGGACTAGCGGT
GGCTCTTTTAACTGTATTGAAGAGAATGAATGTTCCAGGTTGGGAGTAGCTGAAGCATAAGATTTGTTCGTTGAACCACCTCTTGCTGAAGAAGGTGCGC
GGTCTTCGCTTGAGGTGAATATTGAGCCCCAAAAAGAAGTGCTTCCACTACCTGAAGAACCTGGTCTCTCTGCCTCAGCAGCCGATCGTACCCCCTGCTG
GATCTGGTCGGTGATAACTCCATTTACACCAGTGGTTCTACCCAATAATGCACGTGCTTTTTGGGTTTTTTCAGAAGCCTGTGGCCTATCTGCATCTACT
CCATCTCTTCTAACCACTGTTGCAGGCAATCTAGCGGCTCTGACTTGTTGCTGTGCTTGTTCTACAGCCTTGCTACCACCGATGAAACTTGGGTGAGATG
TGTTTATGTAATCGGCCTCCATCTCAATTATGTGTGCTATCATATCTTGTGCTGGCTTAAGCCCATCCCGTAGAAACTTCCCAATTACTTCATCCATGCT
CCTTCTGAGTATAGGAAACTGCTGCAGCTCATTGCTAAGGCAACGGTGGCTCATCTTAACCAGTTCCTCATATATGAAATCTGCACACTGCAGACTTGGA
TCAAGCAATCTACTGATTTGCCTGCGCACAAGGACTTCAAATGGCACCTCAGGTACAAACAAAGCACTCCTAGGACCAGTTGCATTCTGTATAGCCATGC
GGATATCTTCATCAGTGACATC
page-top