Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21689  (registered. 2007)
Contig Information
Length 566 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_SHC Shoot grown with cold treatment 3
Wh_VSCB Liquid cultured tissue 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: similar to germinal histone H4 gene [Canis familiaris]
Score 411
Evalue 1.02107e-38
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21689
TTTTTTTTTTAATTCAGGGGTAAAATGCAGAGATGTCCATTCCATGCTAGTAGTACATCGAAACAACAGACAGCAGCGAGATGCGGCCATTCCATTACAC
CGAAGACCATGAACACTGAACAACCGATGGCTAGCTAAATACGAATCTGGCGGCGCGAGGCGGATTCGACTGGACCGGCGCGGCCTAGCCGCCGAATCCG
TAGAGGGTGCGTCCCTGGCGCTTGAGCGCGTAGACGACGTCCATGGCGGTGACGGTCTTGCGGCGGGCGTGCTCGGTGTAGGTGACGGCGTCGCGGATGA
CGTTCTCCAGGAAGATCTTGAGCACGCCGCGGGTCTCCTCGTAGATGAGCCCCGAGATGCGCTTCACGCCGCCCCTCCGCGCCAGCCGCCGGATCGCCGG
CTTGGTGATGCCCTGGATGTTGTCGCGCAGCACCTTCCGGTGGCGCTTGGCGCCGCCCTTGCCGAGCCCCTTCCCTCCCTTGCCGCGGCCCGACATCCTC
GACGCTTCCCTCTCCGGCGACCTTCCCTTGGCTTGGCTGGTGTGTGTGTGCGCTGCTGGTCTGGTG
page-top