Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21683  (registered. 2007)
Contig Information
Length 2233 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VHS Shoot with heat shock treatment 1
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_25842 [Oryza sativa Indica Group]
Score 1485
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21683
AGCAGTTCATACATGGTTTCTGCCTTGCAGATTTGTGAGATTTCAGGGCCTAACTATTAAGTTGCAAATATTCAAGGACAAAGCATCCATGCGGCCATGT
CAGTATGCAAGATTTTTGACAATTGCTTTGTCATCTGCTGGAGAACATGAAGAATTCGTTTTGGTACTTCCTTACCAAGGAGAGGCCAAGTGAAGTATAT
ATATGGGTAGGGCACAGTTTCAAAAAAGAATTTTCTTTGTATAGTATTGTTGCCCTGTATCCAAATCCAGCTCAACACAGACGAACAAGACGCCATGCAA
AGGCTGCAGATCAACCGATTTTCCTACCCTTCACTGCTGCAAAAACTTGTTCAATGCAGTTGTGTCCAATGCTGAAAATTCACTCGCAGCAGCAAGCACT
GCAAGTCCGAGCTTCATGGCGTCATTCTTGCTTTGTGCCTCAATATTAAGGGGAAGAACCGGATCATGGAGGGATAGCCTCAACATAAACCAGCCACCAT
ATCCAGAAACTCTGACGCCTTCATGATTCTTCGGGGCTTTGTTTAGATTTGGGTCTTTGCTGATCACACTCTCCAAATGTTTCAAGATTGACTCTCCATA
GTCACGGAAGGACCCTCCTTTCAAATCTGCATGATTTTGATCAATCTTCAACCTTATCTCCACTGTCACAGCAGCCTCCTCAAGGCCCTCGACCAAATCA
GTCAAAACTTTACTACCGATGTTTGGGTTCAATGTTCTGGCACCAGCAAGTTTATTCAGAAGTTTAACCATCGTATATGCTCCATCATCGAGCCAGTGAT
TCTCTTTCAGTGCTCCATGGCCACTTGTTTCCATCGCCAAATGTGATTCCTCACCAGTAGAATTCAGACGAATAGCCTCATCTATTACATTCTTGTATCC
TCGCTTGAATCGATGGTGTTTCCCTCCAAGTTTCTTCTCAATAAATGCAGTCAGTCCATCTGATGTCACGCTATCAGTCACAACAGTGGGTTCCTGGATG
CTCCTCAAGAACTATGGCAGACATCAAAGCAATCAATCGGTTGCGATTCAACTCACGTCCACTGGAATCAACAGCAGCTGACCTGTCAACATCAGTATCA
AATATGATGCCCAAGTCTGCCTTATTATTAAGCACTGCTTGTGTAATGGCTTCCATTGCAGCTTTGTCCTCAGGATTCGGAATATGATTGGGAAACAAAC
CATCAGGCTCCAGGAATTGGCTCCCATCAGTAACAGCTCCTAATGGTTTTAGTACCTTATCCACAAAAAAGCCACCTGCTCCATTCCCTGCATCAACAAC
TATGTGCAGTCCCTCCAATGGTTTCTCTTTGTTTCCAGCAGATTTAAGAACTGCTTGCACTAGATCAGAAGCATAAATTGACATGTAGTCCACATGAGTC
ACGACACCGGTCTGTTCTTGTTTGCCACAATGTGCAGATTCCTCGTAAACTCTAGAAGCCCGCTCCAATATATCTTTAATATCAGTCTTATTTAGACCAC
CATCACTTGTAAAAAACTTGAAACCATTCCGATTGTAGGGTAAATGGCTCGCTGTTATCATTATGCCTCCATCTGCTGGGCAATGATTTATCGCATCTTT
GGTAAGTGTACTGTTGAACATTGCCGGTGTTGAAGCCAATCCAAACTGTAGAACATCATGTCCGGCAGCAGTGATTCCATGAGTAATTGCATTCTGCAAT
TTATGAGCAGAAATTCGTGAATCATGTCCAACAGAGATTCTTAAACGTCTCAAGCCATCCGCTTTCTTCTTGTTTAATAACCATGCAGCAAATGCAGCAG
CTATAGCTTCAGCAACAAGCTCCGTAAGATTGACAGGCTCACCTTCAACCCCAGCAATAGCAACACCACGAATATCACTGCCATTTTGTAGCTTGAGAAA
ATCAACTTTGTCAATGGACAAGACATCACTGGCACCTTGAGTAGCATTGCAGCTAATATTTCCTTGTTTCCCGAAGCTAATCCATGCTGTTGATGTGGTA
TTTAACCACTTGGCTGAAGTATCAGCCAATGATAATCTACACCCCTGGACGGAATGCATGCTGCGGGTATTGAGGGCACAAAAGTCACAGGTATATCTTG
GATTGTGCCTAGTCCGTGGACCATCTTGTGCCAAGAATGCATTTTGTATGACCTTCGCTGATAATGCGGCCATGGATGTGAGGAGGAGGAGCTCGCGGGA
AGCCGGCTTTGCTGTGCGTGTGCTCGGACGGCG
page-top