Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21639  (registered. 2007)
Contig Information
Length 1442 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_PCDAM Anther at meiosis 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_15603 [Oryza sativa Indica Group]
Score 1552
Evalue 2.66253e-170
Total Hit Count 275
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21639
TTTTTTTTTTGTGTTCATGATATAATTATGTTATTTTAGGCTTCTTTGGCACATGCAGAGTAGATATGTTTATAGTAGTACAAGTCAACAGTTGCTTCAT
ATTTTGAAAATAAGAAGAACAATTCGTCTTATAATTGTTTTGCAATGTCACTCAAAGTTGCACTTGCCGACCATGGATCCAGCTGAAAGGAACAACCGGT
AACTGCTTTGCCCTGCCCTGAGCTCGCTCCTCCAGCTTCCTGAACCTTGGTCCCAGTGAGCAGAGGAAATCCTGAGCCCGCCTCCCTTCCCCAGACAGCC
CAGTGAGGTTGGCGACGTTCCACCTCTGCACCAGAAAGTCGAGGATGTCGGCGTAGTCCATGGCGGTGTAGATGCCCAGCCGTTGAGCCACCGCGCTGAA
GTGCTCAAACAGGTTGTCATCCTGCCCGTCGTACATCAAGTGGGCGGGCATCGTGACCTTCTTCCTCATCATGGCGGCGAATGCCAGCACGGTGTAGTCG
GGGTCGACCTCGAAGAGCTTCTCCACAATCTTGGTGTAGGCCGTCTCATGGCGCTTCTCGTCGGCCGCGATGGTGCCACATATCTGAGCCAGCTTCAGGT
CCCCGTACTTCCTGGCGTGCCTCGCAGTGTTGCCGTGGGATATGAAGGTTGCCCTCTCTTGGAAAGATGTGTAGATGTAACCCTGATATGGGTTACCCTC
GGTTTTTGGATCCATTCCAGCACCAAGGAGATACTGTATGGTCTTCTCAATCTGCCTCATATCAACCCTCCCAGCGAGGTACATGTACTTGTTCATGAGA
TCACCATGCCTGTTCTCCTCGGCCGTCCATGCCCTCGTCCAGACAGCCCAGCTTGCTGGACTGGTGCCGGTATCATCGCCGACACCGCCATCGAGGATAT
TGAGCATTGTCTGGTAAGTAGGGAGTGCTTCCTCAGTGACCATGTCTCCAACCAGACAGACCAAGTAGTCATCCGGGATCTCCTTGGCCCGTTCCCTCAA
CTCCTTGACTTCATCATAGAATCCATCCGAGGAAGGGTCTGGCAGGTAGTCCTGCGGCTGCCAGGATTTCTCTACTGGCTTCAACAGGACCAGGATGTTG
TCCTCTGCCCAGCGCTCCAGTGAATCGAAAACTTCCTTCTTCTGAGGTGGGAATGGTTGTGCGAATCGGACTCGAGTGGGGGCCTTTTCGGGAGTTCCAA
CCTTGGCCTTGGAAGCCGTGGCCACCACTGTGAATTTCCTCCTCAGGCAAGAAGACACTAAAGGTGCATGGAAGGTGCCGCAGGAAGGCATGTATGCCAT
TAGATACAACAACTTATCAATCCACCAACACCACTTTCAACGCTGAGTTTAGAGTTTGGCAATACTTTGATTCTGCCCACACTTACGTACAAGCTGAGGT
GGGAGGTAGAGTGAGCAGTTGGGAGTGGAGTACTAGTAGTCG
page-top