Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21627  (registered. 2007)
Contig Information
Length 1303 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_36489 [Oryza sativa Indica Group]
Score 1504
Evalue 8.51903e-165
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21627
GTAGTGGTTTATATATATCAAAGTTATCCATTAATCTTGTTTGTAGTAAGGATTACAAGCTAAGATAACTTTACCGGCTCTAACTAGCACATTATGTTCG
CTCGAGAAAAAAAAAGTAGCACATTATGTGCAAATACATTTTTATTTTGACATGTATCTTTTGAATGCAGATCTATGCTGGATCCGGGTCTTGAATGCAG
TAGTAGTGGTACAAAGTGTCACCGCCTCGAGCCGTAGCCAACTTCCTTACCGTTGCTACATCATAGTATCATACTAGTTTTGACTCTTGAGGAAACATTC
AGAAAGCTCATATCCACTTGCTGATGTTTAACCACCATTTTTCATTGTGCAGTTCCCATCTTGGCATCCTTGTACAGCTGATCAACACGATCCTTGTAAT
GTTTGAGCAGCTGGGGCCTCTTGAGCTTAAAAGTTGGGGTGATCAGGTCCTTGTCGATGCTGAATGGCACTGGCTCCAGGTGAACGGCCCTCAGCATCTC
AAATCCTCTCAACCCGAGTTTCTTGCCGGTTTGATTCAGCTCATCCTGGATGTACCTCCTTGCCTTCGGATCATTGCACAACTCAGCGTAGTCACCAGAC
TTGCCGTTAAGTGCAGCCCAGTCCTCAATGGCTTGCTTCTCAGGGACGACCACAGCAACGAGGAAGGACTCGAAGCTGTTCCCGTAGACCCAAACCGATG
CAGCGAGTTGAGACTGCGCGTATGCGCTTTCCAGGACCTCCACTGCTACATACTCCCCCTGGGACAGCTTGAAGATGTTCTTCTTTCTGTCGATGATCTT
CATCGTGCCATCCGGTTGCCACTCCCCGATATCACCTGTGTGGAACCATCCATCTGAGAACACTTCCTCTGTGAGGTCAGGACGCTTGTAGTACCCAGAG
AACAAGGTGTGTCCCCTCAAGCAGATTTCGCCTCGCGGCGCACTGGAGAGCGCGTCGTAGCCCATTTCAGGAACGGACTCCAACCGTGCCTCGACTGCCG
TCACGGGAGGGCCAACCGTCCCAATCATCGAAATAACGTTGGCGATCGACGTAAAGCATCCCGAGCAGCTCTCAGTGAGCCCATATCCTTGTGCGAGGAC
ACTGCAGCTGGTAACTCGCATGAACTCTTCAATGTGTCTTGGCAAAGGTGCCGCGCCTGATAGCATGAGACGTATGCGGCCTCCAAGCCCTTCCTTTATT
TTGCTGAAGACTATTTTGTCAAAAAATGGCGATGCTTCATGCTGTTTGAATCCGTTCATTAAGTTGCCAAGTTTGTAGTTGTAAGCATACTGAAAAAGGT
GCT
page-top