Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21575  (registered. 2007)
Contig Information
Length 635 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_SHC Shoot grown with cold treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown protein [Oryza sativa Japonica Group]
Score 594
Evalue 8.19336e-60
Total Hit Count 319
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21575
TTTTTTTTTTGACGCAGATAAGTCACTCGTTCTCAATTTAGATAAAAGTTGGCAACCATGAGGCAGATACAGCAATGTAAAATCCTAACCTCTTCGACCA
AAGAGACTATTTGCAAGTTACAAATCAAGCAAAGTTGGTACAGATGTATAGCAGCAGCAATAAAACATCAAACAACGATCATGAAGTTCAGGAAGACATG
AGCTTCAAGCCATTGTCCGGCATTCCCATTCCACCAGCGAGATCGGCATCTATTTGCGTGTGTGGGGCTGGCCCAGACAACTGCTTGACCCTTTTCTTGT
GGCGCTTTGAGCGGTAGTGATCCTCCTTTACGGTCTCATCCGCGAAGTACCGATCGCAGTGGAGGCAGTAGAACTGGCCCATGCCGGGGAGGTCCTCGTC
GACGGGTAGCGCCTTGCCCTCGGAATCCTTGCCCTGGTCGGCCAGCTTGACGAGCTCGTCGTAGACGGCGTCGTCGGCTTTGACGAGGAACTTGCCGCGG
CGCACCTGCTTGCAGTTGAGACGGCGCTTCTTCACCTTGCGGTGTGGGCACTTGCCTCCCATCTGAGCTTGCTCGCGGTGGTCGGCGGCGGCGGCTAGGG
TTTCGGCTCCGAGGGGAAACGAACCCGGCACGAGG
page-top