Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1167  (registered. 2012)
Contig Information
Length 1098 bp
Clones alternative view 38 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_dL Crown of seedling 1
Wh_h Spike at heading date 2
Wh_r Root 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 4
Wh_VSCB Liquid cultured tissue 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 2
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 5
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|52548240|gb|AAU82107.1|| 20S proteasome beta 5 subunit [Triticum aestivum]
Score 563
Evalue 1.00E-158
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1167
TCCGCCTCCGCCTCGCCGCACCCCCACACCCGCCGACGACGCCATGATTCCCAACCTCTCCGCCCTCGAGAACCACTTCGGCGCCGCCGCCGCCGGCAGC
GACGACTTCGCCGGCCTCTTCTCCGCCGACGCCGCCGACCAGCTCGCCCTCGAGTTCCCCACCTGCAACGACTTCGATGGGTTCCAGAAGGCGACCAAGG
AGATGGTGAACAACAAGAAGGGGACCACCACGCTCTCCTTCATCTTCGACAAGGGCGTCATCGTCGCCGCCGACTCCCGGGCCAGCATGGGCGGCTACAT
ATCTTCGCAAACTGTGAGGAAAATCATCGAGATTAATCCCTACATGCTGGGAACCATGGCTGGAGGTGCTGCTGATTGCCAATTTTGGCATAGAAACTTG
GGGGTCAAGTGCCGGCTCCATGAGCTCGCGAACAAGCGGAGGATCTCCATTGCTGGTTCTTCAAAGACGTTGGCTAATATCCTTTATTCATACCGCGGGA
TGGGACTTTCAATCGGTACCATGATTGCTGGATTTGATGAAACTGGTCCGGGCTTGTACTATGTTGATAGCGAGGGTGCAAGGCTCAAGGGAAGCCGATT
CTCTGTTGGTTCTGGCTCTCTATATGCTTATGGTATCTTGGACGAGGGTTACAAATTCAACATGTCAGTTGAGGAAGCTGCTGAGTTAGCTCGGCGGGCT
ATTTACCACGCAACATTCCGTGACGGAGCTAGTGGTGGCTGTGTTAGTGTCTACTATGTTGGCCCTGACGGCTGGAAGAAGTTGTCTGGAGATGATGTTG
GAGAGCTGCACTACCACTACTACCCAGTCCAGGCGGCTCCTGTCGAGCAAGAGATGGCCGAGGCCCCTTCTGCGTCAACCTGATTGATGTCATACGAAAT
TCCGTGAACTGTGTTGAAGCACCTTGTTTTATGGACTGGGGGCTTGTTTGTCTCCTCCTCGACATTAGAGTGTTCTCCTCCGAGACCTGCTGATGTTCAC
CTTACGCATCTGTTATGGCAATGTGGTTGTAGACTGATGAATGTTATAGATGTTTCCATGAAGTTTCATTTGAAAAAAAAAACTTGCTAAAAAAAAAA
page-top