Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21531  (registered. 2007)
Contig Information
Length 1409 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 3
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit chlorophyll a/b-binding protein WCAB precursor [Triticum aestivum]
Score 1301
Evalue 3.28221e-141
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21531
CTCAGCCACACTATTGGAGAACACACAGGGACAACACACAATAAGTGCAGCGCAATGGCGGCCACCACCATGTCTCTTTCCTCTTCGTACCTCGCCGGCA
AGGCCGTCAAGAACTTGCCCTCGTCGGCTCTCATTGGTGAGGCACGTGTGAACATGCGCAAGACTGCCGCGAAGGCTAAACAAGTTTCGTCGAGCAGCCC
GTGGTACGGCTCTGACCGTGTGCTCTACCTCGGCCCGCTTTCCGGCGAGCCCCCCAGCTACTTGACTGGTGAGTTCCCCGGTGACTATGGGTGGGACACC
GCCGGGCTCTCGGCTGACCCTGAGACCTTCGCCAAGAACCGGGAGCTTGAGGTGATCCACTGTCGATGGGCCATGCTCGGTGCGCTTGGTTGTGTCTTTC
CCGAATTGCTTGCCCGCAATGGTGTGAAGTTTGGCGAGGCCGTCTGGTTCAAGGCCGGCTCTCAGATCTTCAGCGAGGGTGGCCTCGACTACCTTGGCAA
CCCCAGCCTCGTCCACGCTCAGAGCATCCTCGCCATCTGGGCTTGTCAAGTTGTGCTCATGGGGGCTGTTGAGGGGTACCGCATTGCTGGTGGTCCGCTC
GGCGAGATCGTCGATCCACTCTACCCTGGTGGTAGCTTTGACCCGCTTGGCCTGGCCGACGACCCCGAGGCATTTGCCGAGCTCAAGGTTAAGGAGATCA
AGAATGGCCGCCTCGCAATGTTCTCCATGTTTGGCTTCTTTGTGCAGGCAATTGTCACCGGCAAGGGCCCATTGGAGAACCTTGCCGACCACATTGCCGA
CCCTGTCAACAACAACGCGTGGGCATTCGCCACCAACTTCGTGCCCGGGAAGTAAGACAGGAATGATGGATGCGAATTGTATATACAATTAGCGTTGGGG
AGCCCCTCTACCTGCCTGCTTGCTGACATTGTCGAGGGTCAAGTGGATTGTTTGTTGTGATGTGATTGCTCTTCTTCTCTTGTGGTGTCTTCTTCGGGTG
TGGTTCCGTGCTGCCGGAGTTTTCCTTCTGTGATTACAGTGGTCGGTGAGCACAGTGAAGCGATCTAGGTGTACACTCGGCTCCTTGTTGCCCTTCGGCT
TTGCCAGCGGTGCCGCTGTTGTGTTGTAGACTCGGATGTGTGTGACTCTTCGTCCGGGTGTGGACTCGGTCGCTCATTGCCCTTCGGCTACACCAATAGC
TTTGAGGCATCATGGATGGTCTCGGTTGATTGGAGCTCTTGGTCTACAATGGTGGTGTTCTCATGCAGCCTTCCGTTCGCGAGGACTATGGAAGATGATG
GCATTCCGGTCCTTTTCTTTTTCCCTTCTATTGTGTCAGGTGTAATCTATTTCCTCTCATCCCTGTATTCCTCTGTAATTTCCCGGCTTTGCCGGTTCCT
TCTTAATGA
page-top